PTXBC109392
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109392 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFRSF13B |
| Origin species: | Human |
| Product name: | TNFRSF13B-tumor necrosis factor receptor superfamily, member 13B Gene |
| Size: | 2ug |
| Accessions: | BC109392 |
| Gene id: | 23495 |
| Gene description: | tumor necrosis factor receptor superfamily, member 13B |
| Synonyms: | CD267; CVID; CVID2; IGAD2; RYZN; TNFRSF14B; tumor necrosis factor receptor superfamily member 13B; transmembrane activator and CAML interactor; tumor necrosis factor receptor 13B; TNF receptor superfamily member 13B |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtggcctgggccggagcaggcgaggtggccggagccgtgtggaccaggaggagcgctggtcactcagctgccgcaaggagcaaggcaagttctatgaccatctcctgagggactgcatcagctgtgcctccatctgtggacagcaccctaagcaatgtgcatacttctgtgagaacaagctcaggagcccagtgaaccttccaccagagctcaggagacagcggagtggagaagttgaaaacaattcagacaactcgggaaggtaccaaggattggagcacagaggctcagaagcaagtccagctctcccggggctgaagctgagtgcagatcaggtggccctggtctacagcacgctggggctctgcctgtgtgccgtcctctgctgcttcctggtggcggtggcctgcttcctcaagaagaggggggatccctgctcctgccagccccgctcaaggccccgtcaaagtccggccaagtcttcccaggatcacgcgatggaagccggcagccctgtgagcacatcccccgagccagtggagacctgcagcttctgcttccctgagtgcagggcgcccacgcaggagagcgcagtcacgcctgggacccccgaccccacttgtgctggaaggtgggggtgccacaccaggaccacagtcctgcagccttgcccacacatcccagacagtggccttggcattgtgtgtgtgcctgcccaggaggggggcccaggtgcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 - leucine-rich repeat-containing G protein-coupled receptor 5 - roundabout, axon guidance receptor, homolog 1 (Drosophila) - nuclear factor of activated T-cells 5, tonicity-responsive |