Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RAET1E-retinoic acid early transcript 1E Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAET1E-retinoic acid early transcript 1E Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC103694 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAET1E |
| Origin species: | Human |
| Product name: | RAET1E-retinoic acid early transcript 1E Gene |
| Size: | 2ug |
| Accessions: | BC103694 |
| Gene id: | 135250 |
| Gene description: | retinoic acid early transcript 1E |
| Synonyms: | LETAL; N2DL-4; NKG2DL4; RAET1E2; RL-4; ULBP4; bA350J20.7; NKG2D ligand 4; RAE-1-like transcript 4; lymphocyte effector toxicity activation ligand; retinoic acid early transcript 1E |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgaagaatatccctgacttctagccctgtgcgccttcttttgtttctgctgttgctactaatagccttggagatcatggttggtggtcactctctttgcttcaacttcactataaaatcattgtccagacctggacagccctggtgtgaagcgcaggtcttcttgaataaaaatcttttccttcagtacaacagtgacaacaacatggtcaaacctctgggcctcctggggaagaaggtaaatgccaccagcacttggggagagttgacccaaacgctgggagaagtggggcgagacctcaggatgctcctttgtgacatcaaaccccagataaagaccagtgatccttccactctgcaagtcgagatgttttgtcaacatgaagcagaacggtgcactggtgcatcctggcagttcaccatcaatggagagaaatccctcctctttgacgcaatgaacatgacctggacagtaattaatcatgaagccagtaagatcaaggagacatggaagaaagacagagggctggaaaagtatttcaggaagctctcaaagggagactgcgatcactggctcagggaattcttagggcactgggaggcaatgccagaaccgacagtgtcaccagtaaatgcttcagatatccactggtcttcttctagtctaccagatagatggatcatcctgggggcattcatcctgttacttttaatgggaattgttctcatctgtgtctggtggcaaaatggtgagtggcaggctggtctctggcccttgaggacgtcttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein LOC340017 - hypothetical protein LOC203547 - hypothetical protein LOC283332 - chromosome X open reading frame 1 |