PTXBC104457
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104457 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ODF1 |
| Origin species: | Human |
| Product name: | ODF1-outer dense fiber of sperm tails 1 Gene |
| Size: | 2ug |
| Accessions: | BC104457 |
| Gene id: | 4956 |
| Gene description: | outer dense fiber of sperm tails 1 |
| Synonyms: | CT133; HSPB10; ODF; ODF2; ODF27; ODFP; ODFPG; ODFPGA; ODFPGB; RT7; SODF; outer dense fiber protein 1; cancer/testis antigen 133; heat shock protein beta-10; outer dense fiber of sperm tails, 27-kD; outer dense fiber of sperm tails 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcactgagttgtctcttggacagtgtcagaagggacataaagaaggtggacagagaactaaggcaactgagatgcatcgacgaatttagcacacggtgcctgtgcgacttgtatatgcacccctattgctgctgtgacttgcacccatatccgtactgcttgtgctattccaagcgatcacgctcttgcggcctgtgtgatctctacccatgttgcctgtgtgattataagctttactgtctgcgaccatctctcagaagtttggagaggaaagccatcagagccatagaagatgagaagcgagagcttgccaaactgagaagaacaacaaatagaattctggcttcctcctgctgtagcagtaacattttaggatcggtgaatgtatgcggttttgaacccgatcaagtcaaagttcgagtgaaggatggaaaggtatgtgtgtcggctgagcgggagaacaggtacgactgccttggatcgaaaaagtacagctacatgaacatctgcaaagagttcagcttgccgccctgtgtggatgagaaggatgtaacatactcctatgggctcggcagctgtgtcaagatcgagtctccttgctacccttgcacttctccttgcagcccgtgcagcccgtgcaacccctgcaacccctgcagcccctgcaacccgtgcagcccatatgatccttgcaacccgtgttatccctgtggaagccgattttcctgtaggaagatgattttgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - keratin associated protein 3-1 - keratin associated protein 2-4 - keratin associated protein 9-4 - olfactory receptor pseudogene |