Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
AMICA1-adhesion molecule, interacts with CXADR antigen 1 Gene
PTXBC100797
New product
Data sheet of AMICA1-adhesion molecule, interacts with CXADR antigen 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AMICA1-adhesion molecule, interacts with CXADR antigen 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100797 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AMICA1 |
| Origin species: | Human |
| Product name: | AMICA1-adhesion molecule, interacts with CXADR antigen 1 Gene |
| Size: | 2ug |
| Accessions: | BC100797 |
| Gene id: | 120425 |
| Gene description: | adhesion molecule, interacts with CXADR antigen 1 |
| Synonyms: | AMICA1; AMICA; CREA7-1; CREA7-4; Gm638; junctional adhesion molecule-like; adhesion molecule AMICA; adhesion molecule interacting with CXADR antigen 1; adhesion molecule, interacts with CXADR antigen 1; dendritic-cell specific protein CREA7-1; dendritic-cell specific protein CREA7-4; junction adhesion molecule like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggatgtgttttccagagcacagaagacaaatgtatattcaagatagactggactctgtcaccaggagagcacgccaaggacgaatatgtgctatactattactccaatctcagtgtgcctattgggcgcttccagaaccgcgtacacttgatgggggacatcttatgcaatgatggctctctcctgctccaagatgtgcaagaggctgaccagggaacctatatctgtgaaatccgcctcaaaggggagagccaggtgttcaagaaggcggtggtactgcatgtgcttccagaggagcccaaagagctcatggtccatgtgggtggattgattcagatgggatgtgttttccagagcacagaagtgaaacacgtgaccaaggtagaatggatattttcaggacggcgcgcaaaggaggagattgtatttcgttactaccacaaactcaggatgtctgtggagtactcccagagctggggccacttccagaatcgtgtgaacctggtgggggacattttccgcaatgacggttccatcatgcttcaaggagtgagggagtcagatggaggaaactacacctgcagtatccacctagggaacctggtgttcaagaaaaccattgtgctgcatgtcagcccggaagagcctcgaacactggtgaccccggcagccctgaggcctctggtcttgggtggtaatcagttggtgatcattgtgggaattgtctgtgccacaatcctgctgctccctgttctgatattgatcgtgaagaagacctgtggaaataagagttcagtgaattctacagtcttggtgaagaacacgaagaagactaatccagagataaaagaaaaaccctgccattttgaaagatgtgaaggggagaaacacatttactccccaataattgtacgggaggtgatcgaggaagaagaaccaagtgaaaaatcagaggccacctacatgaccatgcacccagtttggccttctctgaggtcagatcggaacaactcacttgaaaaaaagtcaggtgggggaatgccaaaaacacagcaagccttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - similar to testis specific protein, Y-linked 1 - sulfotransferase family, cytosolic, 1C, member 4 - SET domain containing (lysine methyltransferase) 7 - protein phosphatase 4, regulatory subunit 1-like |