Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C11orf72-chromosome 11 open reading frame 72 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C11orf72-chromosome 11 open reading frame 72 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104448 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C11orf72 |
| Origin species: | Human |
| Product name: | C11orf72-chromosome 11 open reading frame 72 Gene |
| Size: | 2ug |
| Accessions: | BC104448 |
| Gene id: | 283135 |
| Gene description: | chromosome 11 open reading frame 72 |
| Synonyms: | C-K-RAS; CFC2; K-RAS2A; K-RAS2B; K-RAS4A; K-RAS4B; KI-RAS; KRAS1; KRAS2; NS3; RALD; RASK2; c-Ki-ras2; GTPase KRas; K-Ras 2; K-ras p21 protein; Kirsten rat sarcoma viral oncogene homolog; PR310 c-K-ras oncogene; c-Ki-ras; c-Kirsten-ras protein; cellular c-Ki-ras2 proto-oncogene; cellular transforming proto-oncogene; oncogene KRAS2; transforming protein p21; v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog; KRAS proto-oncogene, GTPase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacacaactgccagaactcggcctgaggtctcctaacaacaaatcccccactggtccccacccactggagcacctacttgccaggcttctcaagcgaagaaggagatccactctgatgtcatctcccaggagccttctctgcagcatctcaggtcctggctctcacctcctcagcacccatcccatcctgtgtcactctgtatatcagcctccccagccagcctccaggccacaagccaagaggtatcaagggctcctccctgtcccactggccccacatccactgtgtctatctggtcaactttaccttccaaacattccctgcacagtgatagatggctgtggccctgtcatctctcacctgaaattaacaatgtatccttggggcctcccaccctcacatcttggctcctccagccccttctctgcaaacatggaacagtgggattattataaatctcagacccgttttgcccctttcctgcctgagagtttttgtggttccccactgccctcagaacaaagctcaagaccctttggcctggcattcaaggtcctttgtgctgccacctgtcaacctccccagttccagctcctttggctttgcccatacaagctggatctgcaccagaggatctgtcttcctcccaacttggccctagtcctcctaggagccctttggacgtcacctcccccaggaagctttctgcaaccaccctacaaccgtccctataaactttataaaaccaattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - VENT homeobox homolog (Xenopus laevis) - chromosome 19 open reading frame 30 - chromosome 17 open reading frame 55 - chromosome 6 open reading frame 159 |