No products
Prices are tax excluded
PTXBC100973
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100973 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC119295 |
| Origin species: | Human |
| Product name: | MGC119295-similar to Williams-Beuren syndrome critical region protein 19 Gene |
| Size: | 2ug |
| Accessions: | BC100973 |
| Gene id: | 441273 |
| Gene description: | similar to Williams-Beuren syndrome critical region protein 19 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtggtgggacgaatctgaggagtcgttggaggaggagccacggaaggtgctcgcccctgagcctgaggagatctgggtggcggagatgctgtgtggcctcaagatgaagctgaagcgacggcgagtgtcgctcgtgctccctgagcaccacgaggccttcaacaggctgcttgaggatcctgtcattaaaagattcttggcctgggacaaagatctgagggtgtcggacaagtatctcctggctatggtcatagcgtatttcagccgggccggcttcccctcctggcaataccaacgcattcatttcttcctggctctctacctggccaatgacatggaggaggacgacgaggactccaaacaaaacatcttccacttcctgtataggaagaaccgctctcgcatacccttgctccgtaagcgttggttccagttaggccattccatgaacccgagggccaggaagaaccgctctcgcatacccttgctccgtaagcgtcggttccagttataccgttccacgaacccgagggccaggaagaaccgctctcgcatacccttgctccgtaagcgtcggttccagttataccgttccatgaactcgagggccaggaagaaccgctctcagatagtcctgttccagaaacgacggttccacttcttctgttccatgagctgcagggcttgggtttccccagaggagttggaggagatccaggcttatgacccagagcactgggtgtgggcgcgagatcgcgctcacctttcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - transient receptor potential cation channel, subfamily C, member 1 - transient receptor potential cation channel, subfamily M, member 4 - transient receptor potential cation channel, subfamily M, member 2 - transient receptor potential cation channel, subfamily C, member 7 |