Cart 56 Product Products 6 724,16 € (empty)
-
-
1 x PSMB4-prot...113,40 € -
1 x DYNLRB1-dy...113,40 € -
1 x AXIN2-axin...113,40 € -
1 x KIF26B-kin...113,40 € -
-
1 x C14orf129-...113,40 € -
1 x ARPC5L-act...113,40 € -
1 x GNG4-guani...113,40 € -
1 x NOL12-nucl...113,40 € -
1 x SUPT3H-sup...121,50 € -
1 x CCDC26-coi...113,40 € -
-
1 x MED8-media...113,40 € -
1 x SERPINI1-s...121,50 € -
1 x SERPINB10-...121,50 € -
1 x TCTE3-t-co...113,40 € -
-
1 x RPS17-ribo...113,40 € -
1 x TRIM5-trip...121,50 € -
1 x C1orf135-c...121,50 € -
1 x ICA1L-isle...113,40 € -
1 x BSCL2-Bern...121,50 € -
1 x TPRXL-tetr...113,40 € -
-
-
1 x FAM32A-fam...113,40 € -
1 x ADCK2-aarF...121,50 € -
1 x ARHGAP29-R...121,50 € -
1 x TCEB1-tran...113,40 € -
1 x ATP5S-ATP...113,40 € -
1 x VPS28-vacu...113,40 € -
1 x KIAA0284-K...113,40 € -
1 x SLC30A4-so...121,50 € -
1 x PRCP-proly...121,50 € -
1 x TNFRSF14-t...113,40 € -
1 x FAHD2A-fum...121,50 € -
1 x OPHN1-olig...121,50 € -
1 x CXorf48-ch...113,40 € -
1 x LEFTY1-lef...121,50 € -
1 x RPSA-ribos...121,50 € -
1 x UBXN4-UBX...113,40 € -
1 x EPG5...259,07 € -
1 x TGFA-trans...113,40 € -
1 x REG1A-rege...113,40 € -
1 x PIM1-pim-1...121,50 € -
-
-
1 x ASS1-argin...121,50 € -
1 x C20orf107-...113,40 € -
1 x ATP6V1C1-A...121,50 € -
1 x UBA6-ubiqu...121,50 € -
1 x ACY1-amino...121,50 € -
1 x SNX8-sorti...121,50 € -
1 x GYPB-glyco...113,40 € -
1 x ZPBP-zona...121,50 €
No products
To be determined Shipping
6 724,16 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 56 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 724,16 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 724,16 €
Data sheet of CHIA-chitinase, acidic Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHIA-chitinase, acidic Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036339 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHIA |
| Origin species: | Human |
| Product name: | CHIA-chitinase, acidic Gene |
| Size: | 2ug |
| Accessions: | BC036339 |
| Gene id: | 27159 |
| Gene description: | chitinase, acidic |
| Synonyms: | AMCASE; CHIT2; TSA1902; acidic mammalian chitinase; lung-specific protein TSA1902; chitinase, acidic |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtttctactcctgagaaccgccagactttcatcacctcagtcatcaaattcctgcgccagtatgagtttgacgggctggactttgactgggagtaccctggctctcgtgggagccctcctcaggacaagcatctcttcactgtcctggtgcaggaaatgcgtgaagcttttgagcaggaggccaagcagatcaacaagcccaggctgatggtcactgctgcagtagctgctggcatctccaatatccagtctggctatgagatcccccaactgtcacagtacctggactacatccatgtcatgacctacgacctccatggctcctgggagggctacactggagagaacagccccctctacaaatacccgactgacaccggcagcaacgcctacctcaatgtggattatgtcatgaactactggaaggacaatggagcaccagctgagaagctcatcgttggattccctacctatggacacaacttcatcctgagcaacccctccaacactggaattggtgcccccacctctggtgctggtcctgctgggccctatgccaaggagtctgggatctgggcttactacgagatctgtaccttcctgaaaaatggagccactcagggatgggatgcccctcaggaagtgccttatgcctatcagggcaatgtgtgggttggctatgacaacatcaagagcttcgatattaaggctcaatggcttaagcacaacaaatttggaggcgccatggtctgggccattgatctggatgacttcactggcactttctgcaaccagggcaagtttcccctaatctccaccctgaagaaggccctcggcctgcagagtgcaagttgcacggctccagctcagcccattgagccaataactgctgctcccagtggcagcgggaacgggagcgggagtagcagctctggaggcagctcgggaggcagtggattctgtgctgtcagagccaacggcctctaccccgtggcaaataacagaaatgccttctggcactgcgtgaatggagtcacgtaccagcagaactgccaggccgggcttgtcttcgacaccagctgtgattgctgcaactgggcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - synaptotagmin VII - laminin, gamma 2 - actinin, alpha 3 - BCL6 co-repressor |