Cart 26 Product Products 7 097,20 € (empty)
-
1 x SURF1-surf...121,50 € -
1 x MGC39900-t...113,40 € -
1 x WDR73-WD...121,50 € -
-
-
1 x WDR8-WD...121,50 € -
-
-
1 x UBR7-ubiqu...121,50 € -
1 x WDR88-WD...121,50 € -
1 x MGAT1-mann...121,50 € -
-
-
-
1 x WISP2-WNT1...113,40 € -
-
-
1 x WDR67-WD...121,50 € -
1 x GRAP-GRB2-...113,40 € -
-
-
-
-
-
-
No products
To be determined Shipping
7 097,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 26 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 097,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 097,20 €
Data sheet of DAP3-death associated protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DAP3-death associated protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC107488 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DAP3 |
| Origin species: | Human |
| Product name: | DAP3-death associated protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC107488 |
| Gene id: | 7818 |
| Gene description: | death associated protein 3 |
| Synonyms: | DAP-3; MRP-S29; MRPS29; bMRP-10; 28S ribosomal protein S29, mitochondrial; S29mt; ionizing radiation resistance conferring protein; mitochondrial 28S ribosomal protein S29; death associated protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgctgaaaggaataacaaggcttatctctaggatccataagttggaccctgggcgttttttacacatggggacccaggctcgccaaagcattgctgctcacctagataaccaggttccagttgagagtccgagagctatttcccgcaccaatgagaatgacccggccaagcatggggatcagcacgagggtcagcactacaacatctccccccaggatttggagactgtatttccccatggccttcctcctcgctttgtgatgcaggtgaagacattcagtgaagcttgcctgatggtaaggaaaccagccctagaacttctgcattacctgaaaaacaccagttttgcttatccagctatacgatatcttctgtatggagagaagggaacaggaaaaaccctaagtctttgccatgttattcatttctgtgcaaaacaggactggctgatactacatattccagatgctcatctttgggtgaaaaattgtcgggatcttctgcagtccagctacaacaaacagcgctttgatcaacctttagaggcttcaacctggctgaagaatttcaaaactacaaatgagcgcttcctgaaccagataaaagttcaagagaagtatgtctggaataagagagaaagcactgagaaagggagtcctctgggagaagtggttgaacagggcataacacgggtgaggaacgccacagatgcagttggaattgtgctgaaagagctaaagaggcaaagttctttgggtatgtttcacctcctagtggccgtggatggaatcaatgctctttggggaagaaccactctgaaaagagaagataaaagcccgattgcccccgaggaattagcacttgttcacaacttgaggaaaatgatgaaaaatgattggcatggaggcgccattgtgtcggctttgagccagactgggtctctctttaagccccggaaagcctatctgccccaggagttgctgggaaaggaaggatttgatgccctggatccctttattcccatcctggtttccaactataacccaaaggaatttgaaagttgtattcagtattatttggaaaacaattggcttcaacatgagaaagctcctacagaagaagggaaaaaagagctgctgttcctaagtaacgcgaacccctcgctgctggagcggcactgtgcctacctctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - histone cluster 1, H4h - keratin 8 pseudogene 12 - histone cluster 1, H3h - hypothetical LOC388387 |