Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC2A11-solute carrier family 2 (facilitated glucose transporter), member 11 Gene
PTXBC100809
New product
Data sheet of SLC2A11-solute carrier family 2 (facilitated glucose transporter), member 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC2A11-solute carrier family 2 (facilitated glucose transporter), member 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100809 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC2A11 |
| Origin species: | Human |
| Product name: | SLC2A11-solute carrier family 2 (facilitated glucose transporter), member 11 Gene |
| Size: | 2ug |
| Accessions: | BC100809 |
| Gene id: | 66035 |
| Gene description: | solute carrier family 2 (facilitated glucose transporter), member 11 |
| Synonyms: | GLUT10; GLUT11; solute carrier family 2, facilitated glucose transporter member 11; facilitative glucose transporter GLUT11; glucose transporter protein 10; glucose transporter protein 11; glucose transporter type 10; glucose transporter type 11; glucose transporter-like protein XI; solute carrier family 2 (facilitated glucose transporter), member 11; solute carrier family 2 member 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagagcgctccgaagactgattcagggcaggatcctgctcctgaccatctgcgctgccggcattggtgggacttttcagtttggctataacctctctatcatcaatgccccgaccttgcacattcaggaattcaccaatgagacatggcaggcgcgtactggagagccactgcccgatcacctagtcctgcttatgtggtccctcatcgtgtctctgtatcccctgggaggcctctttggagcactgcttgcaggtcccttggccatcacgctgggaaggaagaagtccctcctggtgaataacatctttgtggtgtcagcagcaatcctgtttggattcagccgcaaagcaggctcctttgagatgatcatgctgggaagactgctcgtgggagtcaatgcaggtgtgagcatgaacatccagcccatgtacctgggggagagcgcccctaaggagctccgaggagctgtggccatgagctcagccatctttacggctctggggatcgtgatgggacaggtggtcggactcagggagctcctaggtggccctcaggcctggcccctgctgctggccagctgcctggtgcccggggcgctccagctcgcctccctgcctctgctccctgaaagcccgcgctacctcctcattgactgtggagacaccgaggcctgcctggcagcactacggcagctacggggctccggggacttggcaggggagctggaggagctggaggaggagcgcgctgcctgccagggctgccgtgcccggcgcccatgggagctgttccagcatcgggccctgaggagacaggtgacaagcctcgtggttctgggcagtgccatggagctctgcgggaatgactcggtgtacgcctacgcctcctccgtgttccggaaggcaggagtgccggaagcgaagatccagtacgcgatcatcgggactgggagctgcgagctgctcacggcggttgttagttgtgtggtaatcgagagggtgggtcggcgcgtgctgctcatcggtgggtacagcctgatgacctgctgggggagcatcttcactgtggccctgtgcctgcagagctccttcccctggacactctacctggccatggcctgcatctttgccttcatcctcagctttggcattggccctgccggagtgacggggatcctggccacagagctgtttgaccagatggccaggcctgctgcctgcatggtctgcggggcgctcatgtggatcatgctcatcctggtcggcctgggatttccctttatcatggaggccttgtcccacttcctctatgtccctttccttggtgtctgtgtctgtggggccatctacactggcctgttccttcctgagaccaaaggcaagaccttccaagagatctccaaggaattacacagactcaacttccccaggcgggcccagggccccacgtggaggagcctggaggttatccagtcaacagaactctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) - solute carrier family 12 (potassium/chloride transporters), member 6 - solute carrier family 12 (potassium/chloride transporters), member 6 - REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) |