Cart 17 Product Products 3 211,54 € (empty)
-
1 x IFI44L-int...121,50 € -
1 x MED9-media...113,40 € -
1 x ZNF134-zin...121,50 € -
1 x PVRIG-poli...121,50 € -
1 x KPNA4-kary...113,40 € -
1 x C14orf49-c...113,40 € -
1 x KLF3-Krupp...121,50 € -
1 x FLJ12529-p...121,50 € -
1 x DHFRL1-dih...113,40 € -
1 x LMBR1L-lim...121,50 € -
1 x CES4-carbo...113,40 € -
1 x SCGB1D4-se...113,40 € -
-
-
-
-
1 x C10orf78-c...121,50 €
No products
To be determined Shipping
3 211,54 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 211,54 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 211,54 €
Data sheet of UBAP1-ubiquitin associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBAP1-ubiquitin associated protein 1 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC098141 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBAP1 |
| Origin species: | Human |
| Product name: | UBAP1-ubiquitin associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC098141 |
| Gene id: | 51271 |
| Gene description: | ubiquitin associated protein 1 |
| Synonyms: | NAG20; UAP; UBAP; UBAP-1; ubiquitin-associated protein 1; nasopharyngeal carcinoma-associated gene 20 protein; ubiquitin associated protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttctaagaagttgggtgcagattttcatgggactttcagttaccttgatgatgtcccatttaagacaggagacaaattcaaaacaccagctaaagttggtctacctattggcttctccttgcctgattgtttgcaggttgtcagagaagtacagtatgacttctctttggaaaagaaaaccattgagtgggctgaagagattaagaaaatcgaagaagccgagcgggaagcagagtgcaaaattgcggaagcagaagctaaagtgaattctaagagtggcccagagggcgatagcaaaatgagcttctccaagactcacagtacagccacaatgccacctcctattaaccccatcctcgccagcttgcagcacaacagcatcctcacaccaactcgggtcagcagtagtgccacgaaacagaaagttctcagcccacctcacataaaggcggatttcaatcttgctgactttgagtgtgaagaagacccatttgataatctggagttaaaaactattgatgagaaggaagagctgagaaatattctggtaggaaccactggacccattatggctcagttattggacaataacttgcccaggggaggctctgggtctgtgttacaggatgaggaggtcctggcatccttggaacgggcaaccctagatttcaagcctcttcataaacccaatggctttataaccttaccacagttgggcaactgtgaaaagatgtcactgtcttccaaagtgtccctcccccctatacctgcagtaagcaatatcaaatccctgtctttccccaaacttgactctgatgacagcaatcagaagacagccaagctggcgagcactttccatagcacatcctgcctccgcaatggcacgttccagaattccctaaagccttccacccaaagcagtgccagtgagctcaatgggcatcacactcttgggctttcagctttgaacttggacagtggcacagagatgccagccctgacatcctcccagatgccttccctctctgttttgtctgtgtgcacagaggaatcatcacctccaaatactggtcccacggtcacccctcctaatttctcagtgtcacaagtgcccaacatgcccagctgtccccaggcctattctgaactgcagatgctgtcccccagcgagcggcagtgtgtggagacggtggtcaacatgggctactcgtacgagtgtgtcctcagagccatgaagaagaaaggagagaatattgagcagattctcgactatctctttgcacatggacagctttgtgagaagggcttcgaccctcttttagtggaagaggctctggaaatgcaccagtgttcagaagaaaagatgatggagtttcttcagttaatgagcaaatttaaggagatgggctttgagctgaaagacattaaggaagttttgctattacacaacaatgaccaggacaatgctttggaagacctcatggctcgggcaggagccagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 5'-nucleotidase, cytosolic IA - unc-93 homolog A (C. elegans) - SEC14-like 3 (S. cerevisiae) - frizzled homolog 5 (Drosophila) |