Cart 29 Product Products 3 658,40 € (empty)
-
1 x REG3A-rege...113,40 € -
1 x EDA-ectody...121,50 € -
1 x EXOSC3-exo...121,50 € -
1 x MYEOV-myel...121,50 € -
1 x SRGN-sergl...113,40 € -
1 x RPS3A-ribo...113,40 € -
1 x KRTAP9-2-k...113,40 € -
1 x HOXD12-hom...113,40 € -
1 x LAPTM5-lys...113,40 € -
1 x BCL2L2-BCL...113,40 € -
-
1 x B3GNT1-UDP...121,50 € -
1 x LOC441493-...113,40 € -
-
-
-
1 x LOC554203-...113,40 € -
1 x KIR3DS1-ki...121,50 € -
-
1 x TRIM21-tri...121,50 € -
1 x KCNK1-pota...121,50 € -
1 x CCDC49-coi...121,50 € -
1 x BBS5-Barde...121,50 € -
1 x DPF3-D4,...121,50 € -
1 x C1orf64-ch...113,40 € -
1 x MRP-L47...259,07 € -
-
1 x ACTL6A-act...121,50 € -
1 x P2RX2-puri...121,50 €
No products
To be determined Shipping
3 658,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 29 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 658,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 658,40 €
Data sheet of GPR50-G protein-coupled receptor 50 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR50-G protein-coupled receptor 50 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC103696 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR50 |
| Origin species: | Human |
| Product name: | GPR50-G protein-coupled receptor 50 Gene |
| Size: | 2ug |
| Accessions: | BC103696 |
| Gene id: | 9248 |
| Gene description: | G protein-coupled receptor 50 |
| Synonyms: | Mel1c; melatonin-related receptor; G protein-coupled receptor 50 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggcccaccctagcggttcccaccccctatggctgtattggctgtaagctaccccagccagaatacccaccggctctaatcatctttatgttctgcgcgatggttatcaccatcgttgtagacctaatcggcaactccatggtcattttggctgtgacgaagaacaagaagctccggaattctggcaacatcttcgtggtcagtctctctgtggccgatatgctggtggccatctacccataccctttgatgctgcatgccatgtccattgggggctgggatctgagccagttacagtgccagatggtcgggttcatcacagggctgagtgtggtcggctccatcttcaacatcgtggcaatcgctatcaaccgttactgctacatctgccacagcctccagtacgaacggatcttcagtgtgcgcaatacctgcatctacctggtcatcacctggatcatgaccgtcctggctgtcctgcccaacatgtacattggcaccatcgagtacgatcctcgcacctacacctgcatcttcaactatctgaacaaccctgtcttcactgttaccatcgtctgcatccacttcgtcctccctctcctcatcgtgggtttctgctacgtgaggatctggaccaaagtgctggcggcccgtgaccctgcagggcagaatcctgacaaccaacttgctgaggttcgcaattttctaaccatgtttgtgatcttcctcctctttgcagtgtgctggtgccctatcaacgtgctcactgtcttggtggctgtcagtccgaaggagatggcaggcaagatccccaactggctttatcttgcagcctacttcatagcctacttcaacagctgcctcaacgctgtgatctacgggctcctcaatgagaatttccgaagagaatactggaccatcttccatgctatgcggcaccctatcatattcttctctggcctcatcagtgatattcgtgagatgcaggaggcccgtaccctggcccgcgcccgtgcccatgctcgcgaccaagctcgtgaacaagaccgtgcccatgcctgtcctgctgtggaggaaaccccgatgaatgtccggaatgttccattacctggtgatgctgcagctggccaccccgaccgtgcctctggccaccctaagccccattccagatcctcctctgcctatcgcaaatctgcctctacccaccacaagtctgtctttagccactccaaggctgcctctggtcacctcaagcctgtctctggccactccaagcctgcctctggtcaccccaagtctgccactgtctaccctaagcctgcctctgtccatttcaaggctgactctgtccatttcaagggtgactctgtccatttcaagcctgactctgttcatttcaagcctgcttccagcaaccccaagcccatcactggccaccatgtctctgctggcagccactccaagtctgccttcagtgctgccaccagccaccctaaacccaccactggccacatcaagccagctaccagccatgctgagcccaccactgctgactatcccaagcctgccactaccagccaccctaagcccactgctgctgacaaccctgagctctctgcctcccattgccccgagatccctgccattgcccaccctgtgtctgacgacagtgacctccctgagtcggcctctagccctgccgctgggcccaccaagcctgctgccagccagctggagtctgacaccatcgctgaccttcctgaccctactgtagtcactaccagtaccaatgattaccatgatgtcgtggttgttgatgttgaagatgatcctgatgaaatggctgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - arylsulfatase family, member K - tweety homolog 2 (Drosophila) - APOBEC1 complementation factor - complement factor H-related 5 |