Cart 61 Product Products 11 247,96 € (empty)
-
-
-
1 x TDG-thymin...121,50 € -
1 x STAMBP-STA...121,50 € -
1 x IGKV1-5-im...113,40 € -
-
-
1 x SRP9-signa...113,40 € -
1 x CBX2-chrom...113,40 € -
1 x TUBE1-tubu...121,50 € -
-
-
1 x F2RL1-coag...121,50 € -
1 x C12orf39-c...113,40 € -
1 x LANCL2-Lan...121,50 € -
-
-
-
1 x MOBKL2C-MO...113,40 € -
1 x FBXO3-F-bo...121,50 € -
1 x DIRC1-disr...113,40 € -
1 x TXNDC8-thi...113,40 € -
-
1 x MED31-medi...113,40 € -
1 x IDH3G-isoc...121,50 € -
1 x FBXW12-F-b...121,50 € -
-
-
-
1 x Goat...203,57 € -
1 x GDPD1-glyc...121,50 € -
1 x BTF3L4-bas...113,40 € -
-
1 x Goat...357,00 € -
1 x Goat...275,00 € -
1 x PRKAR2A-pr...121,50 € -
1 x FBXO4-F-bo...121,50 € -
1 x CCDC43-coi...113,40 € -
-
-
1 x Goat...333,00 € -
1 x ACOT11-acy...113,40 € -
1 x IL22-inter...113,40 € -
1 x HOXA6-home...113,40 € -
-
-
-
1 x MAB21L2-ma...121,50 € -
-
-
-
1 x SNAPC1-sma...121,50 € -
1 x ACTL6A-act...121,50 € -
1 x ZNF468-zin...113,40 € -
1 x BPESC1-ble...113,40 € -
1 x PTPRR-prot...121,50 € -
1 x Histone H3...177,41 € -
1 x Goat...367,38 € -
-
1 x SCPEP1-ser...121,50 € -
No products
To be determined Shipping
11 247,96 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 61 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 11 247,96 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 11 247,96 €
Data sheet of GPR50-G protein-coupled receptor 50 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR50-G protein-coupled receptor 50 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC103696 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR50 |
| Origin species: | Human |
| Product name: | GPR50-G protein-coupled receptor 50 Gene |
| Size: | 2ug |
| Accessions: | BC103696 |
| Gene id: | 9248 |
| Gene description: | G protein-coupled receptor 50 |
| Synonyms: | Mel1c; melatonin-related receptor; G protein-coupled receptor 50 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggcccaccctagcggttcccaccccctatggctgtattggctgtaagctaccccagccagaatacccaccggctctaatcatctttatgttctgcgcgatggttatcaccatcgttgtagacctaatcggcaactccatggtcattttggctgtgacgaagaacaagaagctccggaattctggcaacatcttcgtggtcagtctctctgtggccgatatgctggtggccatctacccataccctttgatgctgcatgccatgtccattgggggctgggatctgagccagttacagtgccagatggtcgggttcatcacagggctgagtgtggtcggctccatcttcaacatcgtggcaatcgctatcaaccgttactgctacatctgccacagcctccagtacgaacggatcttcagtgtgcgcaatacctgcatctacctggtcatcacctggatcatgaccgtcctggctgtcctgcccaacatgtacattggcaccatcgagtacgatcctcgcacctacacctgcatcttcaactatctgaacaaccctgtcttcactgttaccatcgtctgcatccacttcgtcctccctctcctcatcgtgggtttctgctacgtgaggatctggaccaaagtgctggcggcccgtgaccctgcagggcagaatcctgacaaccaacttgctgaggttcgcaattttctaaccatgtttgtgatcttcctcctctttgcagtgtgctggtgccctatcaacgtgctcactgtcttggtggctgtcagtccgaaggagatggcaggcaagatccccaactggctttatcttgcagcctacttcatagcctacttcaacagctgcctcaacgctgtgatctacgggctcctcaatgagaatttccgaagagaatactggaccatcttccatgctatgcggcaccctatcatattcttctctggcctcatcagtgatattcgtgagatgcaggaggcccgtaccctggcccgcgcccgtgcccatgctcgcgaccaagctcgtgaacaagaccgtgcccatgcctgtcctgctgtggaggaaaccccgatgaatgtccggaatgttccattacctggtgatgctgcagctggccaccccgaccgtgcctctggccaccctaagccccattccagatcctcctctgcctatcgcaaatctgcctctacccaccacaagtctgtctttagccactccaaggctgcctctggtcacctcaagcctgtctctggccactccaagcctgcctctggtcaccccaagtctgccactgtctaccctaagcctgcctctgtccatttcaaggctgactctgtccatttcaagggtgactctgtccatttcaagcctgactctgttcatttcaagcctgcttccagcaaccccaagcccatcactggccaccatgtctctgctggcagccactccaagtctgccttcagtgctgccaccagccaccctaaacccaccactggccacatcaagccagctaccagccatgctgagcccaccactgctgactatcccaagcctgccactaccagccaccctaagcccactgctgctgacaaccctgagctctctgcctcccattgccccgagatccctgccattgcccaccctgtgtctgacgacagtgacctccctgagtcggcctctagccctgccgctgggcccaccaagcctgctgccagccagctggagtctgacaccatcgctgaccttcctgaccctactgtagtcactaccagtaccaatgattaccatgatgtcgtggttgttgatgttgaagatgatcctgatgaaatggctgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - arylsulfatase family, member K - tweety homolog 2 (Drosophila) - APOBEC1 complementation factor - complement factor H-related 5 |