Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MT1F-metallothionein 1F Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MT1F-metallothionein 1F Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029453 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MT1F |
| Origin species: | Human |
| Product name: | MT1F-metallothionein 1F Gene |
| Size: | 2ug |
| Accessions: | BC029453 |
| Gene id: | 4494 |
| Gene description: | metallothionein 1F |
| Synonyms: | MT1; metallothionein-1F; MT-1F; MT-IF; metallothionein 1F (functional); metallothionein-IF; metallothionein 1F |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaccccaactgctcctgcgccgctggtgtctcctgcacctgcgctggttcctgcaagtgcaaagagtgcaaatgcacctcctgcaagaagagctgctgctcctgctgccccgtgggctgtagcaagtgtgcccagggctgtgtttgcaaaggggcgtcagagaagtgcagctgctgcgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - metallothionein 1A - protocadherin 21 - metallothionein 1B - synaptotagmin XVI |