Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ST3GAL5-ST3 beta-galactoside alpha-2,3-sialyltransferase 5 Gene
PTXBC065936
New product
Data sheet of ST3GAL5-ST3 beta-galactoside alpha-2,3-sialyltransferase 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ST3GAL5-ST3 beta-galactoside alpha-2,3-sialyltransferase 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC065936 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ST3GAL5 |
| Origin species: | Human |
| Product name: | ST3GAL5-ST3 beta-galactoside alpha-2,3-sialyltransferase 5 Gene |
| Size: | 2ug |
| Accessions: | BC065936 |
| Gene id: | 8869 |
| Gene description: | ST3 beta-galactoside alpha-2,3-sialyltransferase 5 |
| Synonyms: | SATI; SIAT9; SIATGM3S; SPDRS; ST3GalV; lactosylceramide alpha-2,3-sialyltransferase; CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase; ST3 beta-galactoside alpha-23-sialyltransferase 5; ST3Gal V; alpha 2,3-sialyltransferase V; ganglioside GM3 synthase; sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase; GM3 synthase); ST3 beta-galactoside alpha-2,3-sialyltransferase 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaagtgagtacacctatgtgaaactgagaagtgattgctcgaggccttccctgcaatggtacacccgagctcaaagcaagatgagaaggcccagcttgttattaaaagacatcctcaaatgtacattgcttgtgtttggagtgtggatcctttatatcctcaagttaaattatactactgaagaatgtgacatgaaaaaaatgcattatgtggaccctgaccgtgtaaagagagctcagaaatatgctcagcaagtcttgcagaaggaatgtcgtcccaagtttgccaagacatcaatggcgctgttatttgagcacaggtatagcgtggacttactcccttttgtgcagaaggcccccaaagacagtgaagctgagtccaagtacgatcctccttttgggttccggaagttctccagtaaagtccagaccctcttggaactcttgccagagcacgacctccctgaacacttgaaagccaagacctgtcggcgctgtgtggttattggaagcggaggaatactgcacggattagaactgggccacaccctgaaccagttcgatgttgtgataaggttaaacagtgcaccagttgagggatattcagaacatgttggaaataaaactactataaggatgacttatccagagggcgcaccactgtctgaccttgaatattattccaatgacttatttgttgctgttttatttaagagtgttgatttcaactggcttcaagcaatggtaaaaaaggaaaccctgccattctgggtacgactcttcttttggaagcaggtggcagaaaaaatcccactgcagccaaaacatttcaggattttgaatccagttatcatcaaagagactgcctttgacatccttcagtactcagagcctcagtcaaggttctggggccgagataagaacgtccccacaatcggtgtcattgccgttgtcttagccacacatctgtgcgatgaagtcagtttggcgggttttggatatgacctcaatcaacccagaacacctttgcactacttcgacagtcaatgcatggctgctatgaactttcagaccatgcataatgtgacaacggaaaccaagttcctcttaaagctggtcaaagagggagtggtgaaagatctcagtggaggcattgatcgtgaattttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - membrane-spanning 4-domains, subfamily A, member 6A - ChaC, cation transport regulator homolog 2 (E. coli) - dynein, cytoplasmic 2, light intermediate chain 1 - coiled-coil domain containing 5 (spindle associated) |