Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CRYAB-crystallin, alpha B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRYAB-crystallin, alpha B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007008 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRYAB |
| Origin species: | Human |
| Product name: | CRYAB-crystallin, alpha B Gene |
| Size: | 2ug |
| Accessions: | BC007008 |
| Gene id: | 1410 |
| Gene description: | crystallin, alpha B |
| Synonyms: | CMD1II; CRYA2; CTPP2; CTRCT16; HEL-S-101; HSPB5; MFM2; alpha-crystallin B chain; epididymis secretory protein Li 101; heat shock protein beta-5; heat-shock 20 kD like-protein; renal carcinoma antigen NY-REN-27; rosenthal fiber component; crystallin alpha B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacatcgccatccaccacccctggatccgccgccccttctttcctttccactcccccagccgcctctttgaccagttcttcggagagcacctgttggagtctgatcttttcccgacgtctacttccctgagtcccttctaccttcggccaccctccttcctgcgggcacccagctggtttgacactggactctcagagatgcgcctggaaaaggacaggttctctgtcaacctggatgtgaagcacttctccccagaggaactcaaagttaaggtgttgggagatgtgattgaggtgcatggaaaacatgaagagcgccaggatgaacatggtttcatctccagggagttccacaggaaataccggatcccagctgatgtagaccctctcaccattacttcatccctgtcatctgatggggtcctcactgtgaatggaccaaggaaacaggtctctggccctgagcgcaccattcccatcacccgtgaagagaagcctgctgtcaccgcagcccccaagaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ets2 repressor factor - WD repeat domain 16 - WD repeat domain 20 - WD repeat domain 91 |