Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C2orf51-chromosome 2 open reading frame 51 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C2orf51-chromosome 2 open reading frame 51 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029522 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C2orf51 |
| Origin species: | Human |
| Product name: | C2orf51-chromosome 2 open reading frame 51 Gene |
| Size: | 2ug |
| Accessions: | BC029522 |
| Gene id: | 200523 |
| Gene description: | chromosome 2 open reading frame 51 |
| Synonyms: | C2orf51; TSC21; testis-expressed sequence 37 protein; Testis-Specific Conserved gene 21kDa; protein TSC21; testis tissue sperm-binding protein Li 93mP; testis-specific conserved protein of 21 kDa; testis expressed 37 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggtgtgaaatacccgggacaggaccctgtggatttagacatataccaaagctcccacatggtcgactatcagccctacaggaagcacaaatactccagggtcacgccgcaagagcaggcaaagctcgatgctcaactccgggacaaagagttttacaggcccatccctaaccccaaccccaagctaacagatgggtaccctgctttcaaaagaccccacatgactgccaaagacctgggactccccggcttcttcccatcacaggaacatgaggccacgagggaggacgagcgcaagttcaccagcacctgccatttcacatatccagcttcccacgatctgcacctggcccagggtgaccccaaccaggtcctccagagtgctgactttccgtgcctcgtggatcccaaacaccagcctgctgcagagatggccaaaggctacctgctactgccagggtgtccctgtcttcattgccatatagtcaaggtccccatcttgaaccggtggggacccttgatgccattttaccagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein L49 - mitochondrial ribosomal protein L32 - mitochondrial ribosomal protein S25 - mitochondrial ribosomal protein L13 |