Login to display prices
Login to display prices
FAM115C-family with sequence similarity 115, member C Gene View larger

FAM115C-family with sequence similarity 115, member C Gene

PTXBC117233

New product

Data sheet of FAM115C-family with sequence similarity 115, member C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM115C-family with sequence similarity 115, member C Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC117233
Ncbi symbol: FAM115C
Product name: FAM115C-family with sequence similarity 115, member C Gene
Size: 2ug
Accessions: BC117233
Gene id: 285966
Gene description: family with sequence similarity 115, member C
Synonyms: protein FAM115C; FAM115C; FAM139A; TRPM8 channel-associated factor 2; TRP channel-associated factor 2; family with sequence similarity 115, member C; family with sequence similarity 139, member A; TRPM8 channel associated factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccattgctgctgctgcgtttgaggccctcatggatggagtgacatgctgggatgtccccagaggccccatccccagtgaactccttcttattggagaagccgccttccccgtgatggtgaatgacaagggccaggtgctcattgctgcctcctcctacggccgaggccgcctcgtggttgtgtcccatgagggctacctgtcgcatgctggcttggctccatttctcctcaatgcagtgagctggctctgtccctgtcctggggctcccgtgggagtgcatccatccctggcacctctagtaaacatcctacaggatgctgggcttgaggcacaggtcaagccagaaccaggagagcccctaggggtttactgtatcaatgcctacaatgacaccttgactgcaacgctgatccagtttgtgaaacatggagggggcttgttaatcgggggccaggcctggtactgggccagccagcacggccctgacaaggtgctctccaggttccctgggaacaaggtgacaagtgtagccggagtgtacttcactgacacctatggggacagagaccggttcaaggtctctaagaaggtgcccaagatcccactccatgtcaggtatggggaggatgtcaggcaggaccagcagcagctcctggaggggatctcagagctggacatcaggacagggggagtcccctcacagctgcttgtacatggagccctggccttccctctggggctggatgcctcactcaactgcttcctggcggctgctcactatggccggggccgggtggtcctggctgcccacgagtgcctgctctgtgctcccaagatggggcccttcttgctcaatgcggtgcgctggctggccagaggccagacaggcaaagttggggtgaacacaaatctaaaagatctgtgtcctctcctatcggagcatggcctgcaatgcagcctggagccccatctgaacagcgacttgtgtgtctactgctgcaaggcgtacagtgacaaggaggctaagcagctgcaggagtttgtggctgagggtggggggctgctgattgggggccaggcctggtggtgggcctcccagaaccctggccactgccccttggctggcttccctggtaacatcatcctcaactgctttggcctcagcatcctgcctcagactctcaaagcaggctgcttccccgttcccacccctgagatgagaagctaccacttccgcaaggcgctctctcaattccaggctatactgaaccacgagaatgggaacttggaaaagagctgtctggcaaagttgagagttgatggtgcagccttcctacagattcctgcggagggggtccctgcttacatatccctgcacaggctcctgaggaagatgctacgagggtctggcctcccagctgtgagccgggaaaatccagttgccagtgactcctatgaggctgcggtgctctccctggccactgggctggctcactctggaactgactgctcccagctggcccaggggcttggcacctggacctgctcctccagtttgtacccctcaaaacaccccatcaccgtggagatcaatggaatcaacccaggcaacaatgattgctgggtgagtaccgggctctacctcctggaaggacaaaatgcagaagtctcactgtctgaagctgctgcctctgctggcctgagggtacagattggctgccacaccgatgaccttaccaaggccaggaagctatctcgagcccccatggtgactcaccaatgctggatggacaggactgagcggtcagtctcctgcctctggggcggcctcctctacgtcatcgtgcccaagggcagccaactaggccctgtgcctgtcactatcaggggagctgtgcctgccccatactacaagctgggtaagacatcgctggaggagtggaagaggcagatgcaggagaacctggctccctggggagagctggccacggacaacatcatcctgacagtgccaaccacaaaccttcaggccctgaaggaccccgagcctgtgctccgcctctgggatgagatgatgcaggctgtggccaggctggcggctgagcccttccctttccgccgtcctgagaggattgtggctgatgtgcagatctcagctggctggatgcattcaggataccccatcatgtgccacctggagtctgtgaaggagatcatcaatgagatggacatgaggagcaggggtgtgtggggccccatccatgagctgggccacaaccaacagcggcatggatgggagttccccccacacactactgaggccacctgtaacctttggtcagtctacgtgcatgaaacagtcctggggatccccagggctcaggcccacgaggctctgagccctccagagcgagagaggagaatcaaggcccacctgggaaagggagcccccctgtgtgactggaatgtatggacagccctggaaacatatctacaggtactgagcagaaattctgggagaaggggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: