Login to display prices
Login to display prices
PCDHGA9-protocadherin gamma subfamily A, 9 Gene View larger

PCDHGA9-protocadherin gamma subfamily A, 9 Gene

PTXBC132769

New product

Data sheet of PCDHGA9-protocadherin gamma subfamily A, 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCDHGA9-protocadherin gamma subfamily A, 9 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC132769
Ncbi symbol: PCDHGA9
Product name: PCDHGA9-protocadherin gamma subfamily A, 9 Gene
Size: 2ug
Accessions: BC132769
Gene id: 56107
Gene description: protocadherin gamma subfamily A, 9
Synonyms: PCDH-GAMMA-A9; protocadherin gamma-A9; protocadherin gamma subfamily A, 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagctccaaccaaatgccagctccgcggaagattagtcctgctatgctcgctcctggggatgctatgggaggccagggccagtcagattcgctactcagtgcctgaagagacagaaaagggctatattgtgggcaacatctccaaggacctggctctggagccccgggagctggcggagcgccgagtccgcatcgtctctagaggtaggacgcagcttttctctctgaacccgcgcagcggcaccttggtcaccgcgggtaggatagaccgggaggagctctgtgctcagagcccgcggtgtctggtgaactttaaagtcctggttgaagacagagtgaaactgtacggaatagaaatagaagtaactgatattaacgacagcgccccaaagttccaggccgaaagtctggaagtaaaaattaacgaaatcgcggttcctggagcacgttatccacttccagaagctattgatccggatgttggcgtgaactccctccagagctaccagctcagccccaatcaccacttctccctgaacgtgcagactggagacaatggagccataaacccagagctggtgctggagcgcgccctggacagggaggaggcaactgcccaccacctggtcctcacggcctcggatggcggcgagccgcgtcgctccagcacagtgcgcatccatgtgacagtgttggatacaaatgataatgccccggtttttgctcaacggatttaccgagttaaagtccttgagaacgtgcccccaggcacctggctgcttactgcaacagccagcgacctggatgagggaatcaacggaaaagtggcatacaaattctggaaaattaatgaaaaacaatctctgctattccagcttaatgaaaatactggggaaatatcaacagcaaaaagtctagattatgaagaatgttcattttatgaaatggaaatacaagctgaagatggtgggggattgaaagggtggacaaaagtgctcatttcggtggaagatgtaaatgacaatagacctgaagtgaccattacatctctgtttagcccagtgagagaagacgcacctcagggaacagtaattcttcttttcaatgctcatgaccgagactccgggaagaatggtcaagttgtctgttctatccaggagaatctatcttttacattagaaaattcagaagaagattattacagattgttgacggcccaaattcttgaccgagaaaaagcctcagaatataatatcacggtgactgcaacagacagaggaactccgcccctgtccacagaaattcacatcaccctgcaagtgactgacatcaatgataatccacctgctttctctcaagcctcctactcagtctacctcccggaaaacaacgccagaggtacttccatcttctccgtgattgcctatgaccctgatagcaatgagaattctagagttatttactccttggcagaggataccatccaagggtctcctctctccacctatgtctctattaactcagacactggtgtgctgtatgctctgtgctcctttgactatgagcagtttagagatttgcaaatgcaggtgacggcaagtgacagtggaagcccaccacttagcagcaatgtgtcattgagactgtttgttttggaccagaatgacaatgccccagaaatcctgtaccctgccctccccactgatggttctactggtgtggagctggcaccccgctctgcagagcctggctacctggtgaccaaggtggtggcagtggacagagactcaggccagaatgcttggctctcctaccgcctattcaaggccagtgagccagggctcttctcggtggggctgcacacaggtgaagtgcgcacagctcgggccctgctagatagagatgcgctcaaacagagccttgtggtggctgtacaggaccatggccagccccctctctcggccactgtcacgctcacagtagccatagctgacagcatcccagacatcctggctgacctgggcagtcttcagatccctgcagacctggaggcctcagaccttaccctctacctcgttgtggctgtggcagtcgtctcctgtgtcttcctcaccttcgttatcacgctgctggccctcaggctgaggcactggcactcctcgcatctgctgcgggctaccagtgatgggttggctggtgtgcccacctcacactttgtgggtgtagatggggttcgagctttcctacagacctattctcaggagttctccctcaccgctgactcaaggaagagtcacctgatcttcccccagcccaactatgcagacacactcatcagccagcagagctgtgagaaaaatgagcctttgtgcgtctctgttgattccaagtttcctatagaagacacccctttggttccggtgagttcattttttttctttctttcttttctttttttgttttttgttttgttttgtttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: