ATP6V0A4-ATPase, H+ transporting, lysosomal V0 subunit a4 Gene View larger

ATP6V0A4-ATPase, H+ transporting, lysosomal V0 subunit a4 Gene


New product

Data sheet of ATP6V0A4-ATPase, H+ transporting, lysosomal V0 subunit a4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6V0A4-ATPase, H+ transporting, lysosomal V0 subunit a4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC109305
Product type: DNA & cDNA
Ncbi symbol: ATP6V0A4
Origin species: Human
Product name: ATP6V0A4-ATPase, H+ transporting, lysosomal V0 subunit a4 Gene
Size: 2ug
Accessions: BC109305
Gene id: 50617
Gene description: ATPase, H+ transporting, lysosomal V0 subunit a4
Synonyms: ATP6N1B; ATP6N2; RDRTA2; RTA1C; RTADR; STV1; VPH1; VPP2; V-type proton ATPase 116 kDa subunit a isoform 4; ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B; ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 2 (38kD); ATPase, H+ transporting, lysosomal V0 subunit a4; H(+)-transporting two-sector ATPase, noncatalytic accessory protein 1B; V-ATPase 116 kDa; V-type proton ATPase 116 kDa subunit a; vacuolar proton pump 116 kDa accessory subunit; vacuolar proton pump, subunit 2; vacuolar proton translocating ATPase 116 kDa subunit a kidney isoform; ATPase H+ transporting V0 subunit a4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtctgtgtttcgaagcgaggagatgtgtttgtcacaactgtttctccaggtggaagctgcatattgctgtgtggctgagctcggagagctcggattggttcagttcaaagatttaaatatgaatgtgaacagctttcaaaggaaatttgtgaatgaagtcagaaggtgtgaatcactggagagaatcctccgttttctggaagacgagatgcaaaatgagattgtagttcagttgctcgagaaaagcccactgaccccgctcccacgggaaatgattaccctggagactgttctagaaaaactggaaggagagttacaggaagccaaccagaaccagcaggccttgaaacaaagcttcctagaactgacagaactgaaatacctcctgaagaaaacccaagacttctttgagacggaaaccaatttagctgatgatttctttactgaggacacttctggcctcctggagttgaaagcagtgcctgcatatatgaccggaaagttggggttcatagccggtgtgatcaacagggagaggatggcttcctttgagcggttactgtggcgaatctgccgaggaaacgtgtacttgaagttcagtgagatggacgcccctctggaggatcctgtgacgaaagaagaaattcagaagaacatattcatcatattttaccaaggagagcagctcaggcagaaaatcaagaagatctgtgatgggtttcgagccactgtctacccttgcccagagcgtgcggtggagcgcagagagatgttggagagcgtcaatgtgaggctggaagatttaatcaccgtcataacacaaacagagtctcaccgccagcgcctgctgcaggaagccgctgccaactggcactcctggctcatcaaggtgcagaagatgaaagctgtctaccacatcctgaacatgtgcaacatcgacgtcacccagcagtgtgtcatcgccgagatctggttcccggtggcagatgccacacgtatcaagagggcactggagcaaggcatggaactaagtggctcctccatggcccccatcatgaccacagtgcaatctaaaacagcccctcccacatttaacaggaccaataaattcacagctggcttccagaatattgttgatgcctatggtgtcggcagctaccgggagataaacccagccccctacaccatcatcactttccccttcctgttcgctgtgatgtttggagactgtggtcatggaaccgtgatgctcctggctgcactttggatgattctgaatgagagacgcttgctctcccagaagacagacaatgagatttggaacaccttcttccacgggcgctatctgatcctacttatgggcatcttctccatctacacgggtttgatctacaatgactgcttctccaagtccttgaacatctttggctcttcttggagtgtccaacccatgttcagaaacggcacatggaatactcatgtaatggaggaaagtctatatctgcagctggacccagccataccaggagtgtattttggaaatccatacccgtttgggattgatccgatttggaacttggcttcaaacaaactcacatttctgaactcgtataaaatgaagatgtcggtgatcctgggaattgtccagatggttttcggtgtcatcctcagccttttcaatcacatatacttcagaagaactctcaacatcattctgcaatttatccctgagatgatttttatcctgtgtctgtttggatacctggttttcatgatcattttcaaatggtgctgctttgacgtccacgtatctcagcacgcccccagcatcctcatccacttcatcaacatgtttctgtttaactacagtgactcttccaacgcacccctctacaaacatcagcaagaagtccaaagtttctttgtggttatggctttgatttctgtgccgtggatgcttctgattaagccgtttattcttagagccagtcatcggaaatcccagctgcaggcatccaggatccaagaagatgccactgagaacattgaaggtgatagctccagcccttctagccgttctggccagaggacttctgcagatacccacggggctctggacgaccatggagaagagttcaactttggagacgtctttgtccaccaagccatccacaccatcgagtactgcctgggctgcatttcaaacacagcctcctacctgcggctctgggccctcagcctggctcatgcacaactgtctgaagtgctctggactatggtgatgaacagcggccttcagacgcgaggctggggaggaatcgtcggggtttttattatttttgccgtatttgctgtcctgacagtagccatccttctgatcatggagggcctctctgctttcctgcacgccctgcgactgcactgggttgagttccagaacaagttctatgtcggggatggttacaagttttctccattctcctttaaacacatcctggatggcacagccgaggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - intraflagellar transport 80 homolog (Chlamydomonas)
- TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
- cylicin, basic protein of sperm head cytoskeleton 1
- mitogen-activated protein kinase kinase kinase 13

Buy ATP6V0A4-ATPase, H+ transporting, lysosomal V0 subunit a4 Gene now

Add to cart