Login to display prices
Login to display prices
KCTD19-potassium channel tetramerisation domain containing 19 Gene View larger

KCTD19-potassium channel tetramerisation domain containing 19 Gene

PTXBC117335

New product

Data sheet of KCTD19-potassium channel tetramerisation domain containing 19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCTD19-potassium channel tetramerisation domain containing 19 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC117335
Ncbi symbol: KCTD19
Product name: KCTD19-potassium channel tetramerisation domain containing 19 Gene
Size: 2ug
Accessions: BC117335
Gene id: 146212
Gene description: potassium channel tetramerisation domain containing 19
Synonyms: BTB/POZ domain-containing protein KCTD19; potassium channel tetramerisation domain containing 19; testicular tissue protein Li 101; potassium channel tetramerization domain containing 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagtctggcatggctcatgaatcagcagaggacttgtttcatttcaacgtagggggctggcatttctcagttcccagaagcaaactctctcagtttccagactccctgctgtggaaagaggcttcagccttgacctcttcagaaagccagaggctatttatcgacagagatggttccacatttaggcacgtgcactattacctctacacctccaaactctccttctccagttgtgcagaactgaacttgctgtatgagcaagcattgggtttgcagctgatgcctttgctgcagactctagataacctgaaggaagggaaacaccatctacgcgtacggcctgcagacctacctgttgctgagagagcatctctgaactactggcgtacatggaagtgtattagcaaaccctcagaatttccaattaaaagcccagcctttacaggcctacatgataaggcacctctggggctcatggacacacccctgttagacacagaagaggaggtgcactactgcttcctgcccctagacctggtggccaaatatcccagcctagtgactgaagacaacctgctgtggctggctgagacggtggccctcatcgagtgcgagtgcagcgagttccgcttcattgtgaattttcttcgctcacagaagattttactaccggataatttctccaacattgatgtattagaagcagaagtggaaattctggaaatccctgcactcactgaagccgtaaggtggtaccggatgaacatgggtggctgttccccgaccacctgttctcccctgagccccgggaagggggcccgcacagccagcctggagtccgtgaaaccgctctacacaatggccctgggtctgctggtcaagtacccggactctgcgctgggccagcttcgcatcgagagcacgctagacggaagccgactgtacatcacagggaatggcgtcctctttcagcacgtcaagaactggctggggacttgccggctgcccctgacagagaccatttccgaggtatatgagctctgtgccttcctagacaaaagggacatcacctacgagccaatcaaagttgctttgaagactcatctggagccaaggactttggcacccatggatgtgctcaatgagtggacggcagagatcactgtgtattccccacaacagatcatcaaagtgtatgttggaagccactggtacgcaaccaccctgcagacactgctgaagtatccagaactgctgtccaaccctcagagagtgtactggatcacatatggacaaaccctgctcatccacggggatggccagatgttccgacacattctcaacttcctgagacttggcaaactgtttttaccatctgaatttaaggaatggcccctcttctgccaggaggtggaggaataccacattccatccctctcagaagcccttgcacaatgtgaagcatacaagtcatggactcaggagaaagaatctgaaaatgaagaagctttttccatcaggaggctgcatgtggtgacagaagggccagggtcactggtggagttcagtagagacactaaagaaaccacagcctacatgcctgtggacttcgaagactgcagtgacaggactccatggaacaaggctaagggaaacctggtcaggtccaaccagatggatgaggctgagcagtacactcggcccatccaggtgtccctatgccgaaatgccaagagggctggcaaccctagcacatactcacactgccgtggcttgtgtaccaatcctggacactgggggagccaccctgagagccccccaaagaagaaatgcaccacaatcaacctcacacagaaatctgaaaccaaagaccctcccgccactcccatgcaaaaactcatctccctggtgagagaatgggacatggtcaattgcaaacagtgggaattccagccactgacagccacacggagcagccccttggaggaggccaccctgcagctccccttgggaagcgaggctgcttcccagcccagcacctcagctgcctggaaagcccattccacagcctcagagaaggatccaggaccacaggcaggggctggagctggagcgaaagacaaggggccagagccaaccttcaagccatacttacccccaaaaagagctggcaccctgaaggactggagcaagcagaggaccaaggagagagaaagccctgcccctgagcagcctctgcccgaggccagtgaggtggacagcctaggggttatcctcaaagtgactcacccccccgtggtgggcagcgatggcttctgcatgttctttgaggacagcatcatctataccacggagatggacaacctcaggcacacaacacccacagccagtccccagccccaagaagtgactttcctgagtttctctctgtcctgggaagagatgttttatgcacagaaatgtcactgcttcctggctgacatcatcatggattccatcaggcaaaaggaccccaaagccatcacagccaaggtggtctccctggccaatcggctgtggaccctgcacatcagccccaagcagtttgtggtagatttgctggccatcaccggcttcaaggatgaccggcacacccaggagcgcctgtacagctgggtggagcttacactgcccttcgccaggaaatatggccgatgcatggacctgctcatccagaggggcctgtctaggtctgtctcttactccatcctgggaaagtacctacaagaggactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice