REST-RE1-silencing transcription factor Gene View larger

REST-RE1-silencing transcription factor Gene


New product

Data sheet of REST-RE1-silencing transcription factor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about REST-RE1-silencing transcription factor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC132859
Product type: DNA & cDNA
Ncbi symbol: REST
Origin species: Human
Product name: REST-RE1-silencing transcription factor Gene
Size: 2ug
Accessions: BC132859
Gene id: 5978
Gene description: RE1-silencing transcription factor
Synonyms: NRSF; WT6; XBR; RE1-silencing transcription factor; RE1-silencing transcription factor variant E1a/E2/E3/E4c; RE1-silencing transcription factor variant E1a/E2/E3/E5; RE1-silencing transcription factor variant E1a/E2/E3/N3a/E4i; RE1-silencing transcription factor variant E1a/E2/E3/N3c/E4; RE1-silencing transcription factor variant E1a/E2/E4; RE1-silencing transcription factor variant E1a/E2/E5; RE1-silencing transcription factor variant E1a/E2a/E2k; RE1-silencing transcription factor variant E1a/E2d/E4g; RE1-silencing transcription factor variant E1a/E2e/E4h; RE1-silencing transcription factor variant E1a/E2f/E4e; RE1-silencing transcription factor variant E1a/E2k/E2i/E3/E4j; RE1-silencing transcription factor variant E1b/E2/E3/E5; RE1-silencing transcription factor variant E1b/E2/E3/N3b/E4i; RE1-silencing transcription factor variant E1b/E2/E3/N3c/E4; RE1-silencing transcription factor variant E1b/E2a/E2k; RE1-silencing transcription factor variant E1b/E2c/E2j/E3/E4; RE1-silencing transcription factor variant E1b/E2e/E4h; RE1-silencing transcription factor variant E1c/E2/E3/E5; RE1-silencing transcription factor variant E1c/E2a/E2k; RE1-silencing transcription factor variant E1c/E2g/E3/E4; neural-restrictive silencer factor; neuron restrictive silencer factor; repressor binding to the X2 box; RE1 silencing transcription factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccacccaggtaatggggcagtcttctggaggaggagggctgtttaccagcagtggcaacattggaatggccctgcctaacgacatgtatgacttgcatgacctttccaaagctgaactggccgcacctcagcttattatgctggcaaatgtggccttaactggggaagtaaatggcagctgctgtgattacctggtcggtgaagaaagacagatggcagaactgatgccggttggggataacaacttttcagatagtgaagaaggagaaggacttgaagagtctgctgatataaaaggtgaacctcatggactggaaaacatggaactgagaagtttggaactcagcgtcgtagaacctcagcctgtatttgaggcatcaggtgctccagatatttacagttcaaataaagatcttccccctgaaacacctggagcggaggacaaaggcaagagctcgaagaccaaaccctttcgctgtaagccatgccaatatgaagcagaatctgaagaacagtttgtgcatcacatcagagttcacagtgctaagaaattttttgtggaagagagtgcagagaagcaggcaaaagccagggaatctggctcttccactgcagaagagggagatttctccaagggccccattcgctgtgaccgctgcggctacaatactaatcgatatgatcactatacagcacacctgaaacaccacaccagagctggggataatgagcgagtctacaagtgtatcatttgcacatacacaacagtgagcgagtatcactggaggaaacatttaagaaaccattttccaaggaaagtatacacatgtggaaaatgcaactatttttcagacagaaaaaacaattatgttcagcatgttagaactcatacaggagaacgcccatataaatgtgaactttgtccttactcaagttctcagaagactcatctaactagacatatgcgtactcattcaggtgagaagccatttaaatgtgatcagtgcagttatgtggcctctaatcaacatgaagtaacccgccatgcaagacaggttcacaatgggcctaaacctcttaattgcccacactgtgattacaaaacagcagatagaagcaacttcaaaaaacatgtagagctacatgtgaacccacggcagttcaattgccctgtatgtgactatgcagcttccaagaagtgtaatctacagtatcacttcaaatctaagcatcctacttgtcctaataaaacaatggatgtctcaaaagtgaaactaaagaaaaccaaaaaacgagaggctgacttgcctgataatattaccaatgaaaaaacagaaatagaacaaacaaaaataaaaggggatgtggctggaaagaaaaatgaaaagtccgtcaaagcagagaaaagagatgtctcaaaagagaaaaagccttctaataatgtgtcagtgatccaggtgactaccagaactcgaaaatcagtaacagaggtgaaagagatggatgtgcatacaggaagcaattcagaaaaattcagtaaaactaagaaaagcaaaaggaagctggaagttgacagccattctttacatggtcctgtgaatgatgaggaatcttcaacaaaaaagaaaaagaaggtagaaagcaaatccaaaaataatagtcaggaagtgccaaagggtgacagcaaagtggaggagaataaaaagcaaaatacttgcatgaaaaaaagtacaaagaagaaaactctgaaaaataaatcaagtaagaaaagcagtaagcctcctcagaaggaacctgttgagaagggatctgctcagatggaccctcctcagatggggcctgctcccacagaggcggttcagaaggggcccattcaggtggagccgccacctcccatggagcatgctcagatggagggtgcccagatacggcctgctcctgacgagcctgttcagatggaggtggttcaggaggggcctgctcagaaggagctgctgcctcccgtggagcctgctcagatggtgggtgcccaaattgtacttgctcacatggagctgcctcctcccatggagactgctcagacggaggttgcccaaatggggcctgctcccatggaacctgctcagatggaggttgcccaggtagaatctgctcccatgcaggtggtccagaaggagcctgttcagatggagctgtctcctcccatggaggtggtccagaaggagcctgttcagatagagctgtctcctcccatggaggtggtccagaaggaacctgttaagatagagctgtctcctcccatagaggtggtccagaaggagcctgttcagatggagttgtctcctcccatgggggtggttcagaaggagcctgctcagagggagccacctcctcccagagagcctccccttcacatggagccaatttccaaaaagcctcctctccgaaaagataaaaaggaaaagtctaacatgcagagtgaaagggcacggaaggagcaagtccttattgaagttggcttagtgcctgttaaagatagctggcttctaaaggaaagtgtaagcacagaggatctctcaccaccatcaccaccactgccaaaggaaaatttaagagaagaggcatcaggagaccaaaaattactcaacacaggtgaaggaaataaagaagcccctcttcagaaagtaggagcagaagaggcagatgagagcctacctggtcttgctgctaatatcaacgaatctacccatatttcatcctctggacaaaacttgaatacgccagagggtgaaactttaaatggtaaacatcagactgacagtatagtttgtgaaatgaaaatggacactgatcagaacacaagagagaatctcactggtataaattcaacagttgaagaaccagtttcaccaatgcttcccccttcagcagtagaagaacgtgaagcagtgtccaaaactgcactggcatcacctcctgctacaatggcagcaaatgagtctcaggaaattgatgaagatgaaggcatccacagccatgaaggaagtgacctaagtgacaacatgtcagagggtagtgatgattctggattgcatggggctcggccagttccacaagaatctagcagaaaaaatgcaaaggaagcgttggcagtcaaagcggctaagggagattttgtttgtatcttctgtgatcgttctttcagaaagggaaaagattacagcaaacacctcaatcgccatttggttaatgtgtactatcttgaagaagcagctcaagggcaggagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FERM and PDZ domain containing 4
- oxysterol binding protein-like 8
- coiled-coil domain containing 66
- glutamate receptor, metabotropic 4

Buy REST-RE1-silencing transcription factor Gene now

Add to cart