Cart 7 Product Products 1 489,21 € (empty)
No products
To be determined Shipping
1 489,21 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 489,21 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 489,21 €
Data sheet of GAL3ST2-galactose-3-O-sulfotransferase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GAL3ST2-galactose-3-O-sulfotransferase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117293 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GAL3ST2 |
| Origin species: | Human |
| Product name: | GAL3ST2-galactose-3-O-sulfotransferase 2 Gene |
| Size: | 2ug |
| Accessions: | BC117293 |
| Gene id: | 64090 |
| Gene description: | galactose-3-O-sulfotransferase 2 |
| Synonyms: | GAL3ST-2; GP3ST; galactose-3-O-sulfotransferase 2; beta-galactose-3-O-sulfotransferase 2; gal 3-O-sulphotransferase; gal-beta-1, 3-GalNAc 3'-sulfotransferase 2; galbeta1-3GalNAc 3'-sulfotransferase 2; glycoprotein beta-Gal 3'-sulfotransferase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgtccttgctgggcggcttgcagagatacttccgggtcatcctcctcctcctcctggccctgactctgctcctgctggccggattcctgcactcggacttagagctggacacacccctgtttgggggccaggctgaggggccgccggtcaccaacatcatgttcctgaagacgcacaagacggccagcagcacggtgctcaacatcctctaccgcttcgccgagacccacaacctgtccgtggcgctgcccgccggctcacgcgtccacctgggctacccctggctcttcctggcgcgctacgtggaaggcgtggggtcgcagcagcgcttcaacatcatgtgcaaccacctgaggttcaacctgcctcaggtgcagaaagtcatgcccaacgacaccttctacttctccatcctgaggaaccccgtgttccagctggagtcctccttcatctactacaaaacctacgcccccgccttccggggcgccccgagcctggacgcgttcctggcctcgccgcggacgttctacaacgacagccgccacctcaggaacgtctacgccaagaacaacatgtggttcgacttcggcttcgaccccaacgcgcagtgcgaggagggctacgtgcgcgcgcgcatcgccgaggtggagcggcgcttccggctggtgctcatcgccgagcacctggacgagtccctggtgctgctgcggcgccggctgcgctgggcgctggacgacgtggtggccttcaggctcaactcccgcagcgcgcgctccgtggcccgcctgtcgcccgagacccgggagcgcgcgcggagctggtgcgcgctggactggcgcctgtacgagcatttcaaccgcaccctctgggcgcagctgcgcgccgagctggggccgcggcggctgcgcggggaggtggagcggctgcgcgcccggaggcgcgaactcgcgagcctgtgcctgcaggacggcggcgcgctcaagaaccacacgcagatcagagacccgcgcctgcgcccctaccagtccggcaaggccgacatcctgggttacaacctccggccgggcctggacaaccagacgctgggcgtgtgccagaggcttgtgatgcctgagctccagtacatggcccgcctgtacgccctgcagttcccggagaagcccctcaagaacatcccgttcctgggggcgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitogen-activated protein kinase 8 - tetratricopeptide repeat domain 26 - intersectin 1 (SH3 domain protein) - diaphanous homolog 2 (Drosophila) |