Cart 35 Product Products 6 894,29 € (empty)
-
1 x C13orf16-c...113,40 € -
1 x ZXDC-ZXD...121,50 € -
-
-
-
1 x FITC-Linke...180,32 € -
-
-
1 x MAX-MYC...113,40 € -
1 x RPS3A-ribo...113,40 € -
1 x CRYGS-crys...113,40 € -
1 x SAMD14-ste...121,50 € -
-
1 x RNF125-rin...113,40 € -
1 x ZC3H10-zin...121,50 € -
-
-
-
1 x DKFZp761E1...113,40 € -
1 x NMNAT2-nic...121,50 € -
1 x HAT1-histo...121,50 € -
-
-
-
1 x RPL23A-rib...113,40 € -
1 x CRP-C-reac...113,40 € -
-
-
-
1 x RPL35A-rib...113,40 € -
1 x RNF146-rin...121,50 € -
1 x GPR17-G...121,50 € -
-
-
No products
To be determined Shipping
6 894,29 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 35 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 894,29 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 894,29 €
Data sheet of BARHL2-BarH-like homeobox 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BARHL2-BarH-like homeobox 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC126439 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BARHL2 |
| Origin species: | Human |
| Product name: | BARHL2-BarH-like homeobox 2 Gene |
| Size: | 2ug |
| Accessions: | BC126439 |
| Gene id: | 343472 |
| Gene description: | BarH-like homeobox 2 |
| Synonyms: | barH-like 2 homeobox protein; BarH like homeobox 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacaatggaaggggccagcgggtcgagttttggaatagacacgattttgtccagtgccagttcaggcagcccaggcatgatgaatggagatttccgcccgctcggtgaggccaggaccgcggattttaggagtcaggccaccccatctccctgttcggagattgataccgtagggacggcgccttcttctcctatctcagtcaccatggagcccccggagccgcatctggtagcagacgcgacccagcatcatcaccacctccaccacagccagcagccgccgccgccggccgcggccccgacgcaaagtttgcagcctttgccccaacagcagcagccgctgccgccacagcagccgccgccgccgcccccccagcagctgggctcggccgcctcggcccccaggacttccacgtcttcttttttaattaaggacatcttgggcgacagcaaacctctggcggcatgtgcaccctacagcaccagcgtatcctctccccaccacaccccgaagcaggagagcaacgcagtgcacgagagcttcaggccaaagctcgagcaggaggacagcaagaccaaactcgacaagcgggaggattcccagagcgacatcaaatgccacgggacaaaggaggaaggagaccgggagattacgagtagccgtgagagtccccctgtgagagccaagaagcctcgaaaagcaaggacagctttttccgaccaccagctcaatcaactggagcgtagctttgagcggcagaagtacctgagcgtgcaggatcgcatggacctggctgcagcgctcaacctcactgacacccaagtcaagacctggtaccagaaccgcaggaccaagtggaagcggcagacagcggtgggcctggagttgctggccgaggcagggaactactcggcgctgcagaggatgtttccatcgccttatttctatcacccaagcctgctgggcagcatggacagcactacggcggcggcggctgccgctgccatgtacagcagcatgtaccggactcctccagcaccccatccccagctgcagcggcccctggtgccccgtgtgctcatccacggcctagggcctgggggacagccagcccttaatccattgtccagccccatcccaggcaccccacacccccggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protocadherin beta 7 - clock homolog (mouse) - protocadherin beta 2 - protocadherin beta 4 |