Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of EGLN3-egl nine homolog 3 (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EGLN3-egl nine homolog 3 (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064924 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EGLN3 |
| Origin species: | Human |
| Product name: | EGLN3-egl nine homolog 3 (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC064924 |
| Gene id: | 112399 |
| Gene description: | egl nine homolog 3 (C. elegans) |
| Synonyms: | HIFP4H3; HIFPH3; PHD3; egl nine homolog 3; HIF-PH3; HIF-prolyl hydroxylase 3; HPH-1; HPH-3; egl nine-like protein 3 isoform; hypoxia-inducible factor prolyl hydroxylase 3; prolyl hydroxylase domain-containing protein 3; egl-9 family hypoxia inducible factor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccctgggacacatcatgaggctggacctggagaaaattgccctggagtacatcgtgccctgtctgcacgaggtgggcttctgctacctggacaacttcctgggcgaggtggtgggcgactgcgtcctggagcgcgtcaagcagctgcactgcaccggggccctgcgggacggccagctggcggggccgcgcgccggcgtctccaagcgacacctgcggggcgaccagatcacgtggatcgggggcaacgaggagggctgcgaggccatcagcttcctcctgtccctcatcgacaggctggtcctctactgcgggagccggctgggcaaatactacgtcaaggagaggtctaaggcaatggtggcttgctatccgggaaatggaacaggttatgttcgccacgtggacaaccccaacggtgatggtcgctgcatcacctgcatctactatctgaacaagaattgggatgccaagctacatggtgggatcctgcggatatttccagaggggaaatcattcatagcagatgtggagcccatttttgacagactcctgttcttctggtcagatcgtaggaacccacacgaagtgcagccctcttacgcaaccagatatgctatgactgtctggtactttgatgctgaagaaagggcagaagccaaaaagaaattcaggaatttaactaggaaaactgaatctgccctcactgaagactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TATA box binding protein like 2 - interleukin 20 receptor, alpha - microtubule-associated protein 6 - ubiquitin specific peptidase 29 |