Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TICAM2-toll-like receptor adaptor molecule 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TICAM2-toll-like receptor adaptor molecule 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109266 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TICAM2 |
| Origin species: | Human |
| Product name: | TICAM2-toll-like receptor adaptor molecule 2 Gene |
| Size: | 2ug |
| Accessions: | BC109266 |
| Gene id: | 353376 |
| Gene description: | toll-like receptor adaptor molecule 2 |
| Synonyms: | MyD88-4; TICAM-2; TIRAP3; TIRP; TRAM; TIR domain-containing adapter molecule 2; NF-kappa-B-activating protein 502; TRIF-related adaptor molecule; cytoplasmic adaptor; toll-like receptor adaptor protein 3; toll/interleukin-1 receptor (TIR) domain-containing adapter protein; toll like receptor adaptor molecule 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtatcgggaagtctaaaataaattcctgccctctttctctctcttggggtaaaaggcacagtgtggatacaagtccaggatatcatgagtcagattccaagaagtctgaagatctatccttgtgtaatgttgctgagcacagcaatacaacagaggggccaacaggaaagcaggagggagctcagagcgtggaagagatgtttgaagaagaagctgaagaagaggtgttcctcaaatttgtgatattgcatgcagaagatgacacagatgaagccctcagagtccagaatctgctacaagatgactttggtatcaaacccggaataatctttgctgagatgccatgtggcagacagcatttacagaatttagatgatgctgtaaatgggtctgcatggacaatcttattactgactgaaaactttttaagagatacttggtgtaatttccagttctatacgtccctaatgaactccgttaacaggcagcataaatacaactctgttatacccatgcggcccctgaacaatccccttccccgagaaaggactccctttgccctccaaaccatcaatgccttagaggaagaaagtcgtggatttcctacacaagtagaaagaatttttcaggagtctgtgtataagacacaacaaactatatggaaagagacaagaaatatggtacaaagacaatttattgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 12 open reading frame 42 - transmembrane protease, serine 11E - cholinergic receptor, nicotinic, gamma - solute carrier family 22, member 14 |