Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CD79A-CD79a molecule, immunoglobulin-associated alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD79A-CD79a molecule, immunoglobulin-associated alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113731 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD79A |
| Origin species: | Human |
| Product name: | CD79A-CD79a molecule, immunoglobulin-associated alpha Gene |
| Size: | 2ug |
| Accessions: | BC113731 |
| Gene id: | 973 |
| Gene description: | CD79a molecule, immunoglobulin-associated alpha |
| Synonyms: | CD79a molecule; CD79a molecule, immunoglobulin-associated alpha; CD79a antigen (immunoglobulin-associated alpha); IGA; MB-1; B-cell antigen receptor complex-associated protein alpha chain; MB-1 membrane glycoprotein; ig-alpha; membrane-bound immunoglobulin-associated protein; surface IgM-associated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgggggtccaggagtcctccaagctctgcctgccaccatcttcctcctcttcctgctgtctgctgtctacctgggccctgggtgccaggccctgtggatgcacaaggtcccagcatcattgatggtgagcctgggggaagacgcccacttccaatgcccgcacaatagcagcaacaacgccaacgtcacctggtggcgcgtcctccatggcaactacacgtggccccctgagttcttgggcccgggcgaggaccccaatggtacgctgatcatccagaatgtgaacaagagccatgggggcatatacgtgtgccgggtccaggagggcaacgagtcataccagcagtcctgcggcacctacctccgcgtgcgccagccgccccccaggcccttcctggacatgggggagggcaccaagaaccgaatcatcacagccgaggggatcatcctcctgttctgcgcggtggtgcctgggacgctgctgctgttcaggaaacgatggcagaacgagaagctcgggttggatgccggggatgaatatgaagatgaaaacctttatgaaggcctgaacctggacgactgctccatgtatgaggacatctcccggggcctccagggcacctaccaggatgtgggcagcctcaacataggagatgtccagctggagaagccgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tubulin tyrosine ligase-like family, member 10 - family with sequence similarity 187, member B - gamma-aminobutyric acid (GABA) receptor, rho 2 - aspartate beta-hydroxylase domain containing 1 |