Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PDCD1LG2-programmed cell death 1 ligand 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PDCD1LG2-programmed cell death 1 ligand 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113678 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PDCD1LG2 |
| Origin species: | Human |
| Product name: | PDCD1LG2-programmed cell death 1 ligand 2 Gene |
| Size: | 2ug |
| Accessions: | BC113678 |
| Gene id: | 80380 |
| Gene description: | programmed cell death 1 ligand 2 |
| Synonyms: | B7DC; Btdc; CD273; PD-L2; PDCD1L2; PDL2; bA574F11.2; programmed cell death 1 ligand 2; B7 dendritic cell molecule; B7-DC; PD-1-ligand 2; PDCD1 ligand 2; butyrophilin B7-DC; programmed death ligand 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcttcctcctgctaatgttgagcctggaattgcagcttcaccagatagcagctttattcacagtgacagtccctaaggaactgtacataatagagcatggcagcaatgtgaccctggaatgcaactttgacactggaagtcatgtgaaccttggagcaataacagccagtttgcaaaaggtggaaaatgatacatccccacaccgtgaaagagccactttgctggaggagcagctgcccctagggaaggcctcgttccacatacctcaagtccaagtgagggacgaaggacagtaccaatgcataatcatctatggggtcgcctgggactacaagtacctgactctgaaagtcaaagcttcctacaggaaaataaacactcacatcctaaaggttccagaaacagatgaggtagagctcacctgccaggctacaggttatcctctggcagaagtatcctggccaaacgtcagcgttcctgccaacaccagccactccaggacccctgaaggcctctaccaggtcaccagtgttctgcgcctaaagccaccccctggcagaaacttcagctgtgtgttctggaatactcacgtgagggaacttactttggccagcattgaccttcaaagtcagatggaacccaggacccatccaacttggctgcttcacattttcatcccctcctgcatcattgctttcattttcatagccacagtgatagccctaagaaaacaactctgtcaaaagctgtattcttcaaaagacacaacaaaaagacctgtcaccacaacaaagagggaagtgaacagtgctatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - syndecan binding protein (syntenin) - coronin, actin binding protein, 1A - coiled-coil domain containing 113 - diacylglycerol kinase, epsilon 64kDa |