Cart 22 Product Products 2 841,96 € (empty)
-
-
-
1 x TRPV5-tran...121,50 € -
1 x GCSH-glyci...113,40 € -
1 x GHSR-growt...121,50 € -
-
-
1 x NDRG2-NDRG...121,50 € -
1 x TCEB2-tran...113,40 € -
1 x TEX12-test...113,40 € -
1 x PHLDA2-ple...113,40 € -
1 x NGB-neurog...113,40 € -
1 x C20orf103-...121,50 € -
1 x ATOX1-ATX1...113,40 € -
-
1 x DBF4B-DBF4...121,50 € -
1 x FASN-fatty...121,50 € -
-
-
1 x DBNDD2-dys...113,40 € -
1 x RHBDD2-rho...113,40 € -
No products
To be determined Shipping
2 841,96 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 841,96 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 841,96 €
Data sheet of SHISA2-shisa homolog 2 (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SHISA2-shisa homolog 2 (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC132898 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SHISA2 |
| Origin species: | Human |
| Product name: | SHISA2-shisa homolog 2 (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC132898 |
| Gene id: | 387914 |
| Gene description: | shisa homolog 2 (Xenopus laevis) |
| Synonyms: | C13orf13; PRO28631; TMEM46; WGAR9166; bA398O19.2; hShisa; protein shisa-2 homolog; shisa homolog 2; transmembrane protein 46; shisa family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggggcgctcgccgctcgtccgtctcctcatcctggaacgccgcttcgctcctgcagctgctgctggctgcgctgctggcggcgggggcgagggccagcggcgagtactgccacggctggctggacgcgcagggcgtctggcgcatcggcttccagtgtcccgagcgcttcgacggcggcgacgccaccatctgctgcggcagctgcgcgttgcgctactgctgctccagcgccgaggcgcgcctggaccagggcggctgcgacaatgaccgccagcagggcgctggcgagcctggccgggcggacaaagacggccccgacggctcggcagtgcccatctacgtgccgttcctcattgttggctccgtgtttgtcgcctttatcatcttggggtccctggtggcagcctgttgctgcagatgtctccggcctaagcaggatccccagcagagccgagccccagggggtaaccgcttgatggagaccatccccatgatccccagtgccagcacctcccgggggtcgtcctcacgccagtccagcacagctgccagttccagctccagcgccaactcaggggcccgggcgcccccaacaaggtcacagaccaactgttgcttgccggaagggaccatgaacaacgtgtatgtcaacatgcccacgaatttctctgtgctgaactgtcagcaggccacccagattgtgccacatcaagggcagtatctgcatcccccatacgtggggtacacggtgcagcacgactctgtgcccatgacagctgtgccacctttcatggacggcctgcagcctggctacaggcagattcagtcccccttccctcacaccaacagtgaacagaagatgtacccagcggtgactgtataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - outer dense fiber of sperm tails 3 - coiled-coil domain containing 17 - death-associated protein kinase 3 - glutamate receptor, metabotropic 2 |