Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RHOQ-ras homolog gene family, member Q Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RHOQ-ras homolog gene family, member Q Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC056154 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RHOQ |
| Origin species: | Human |
| Product name: | RHOQ-ras homolog gene family, member Q Gene |
| Size: | 2ug |
| Accessions: | BC056154 |
| Gene id: | 23433 |
| Gene description: | ras homolog gene family, member Q |
| Synonyms: | rho-related GTP-binding protein RhoQ; ARHQ; HEL-S-42; RASL7A; TC10A; RAS-like, family 7, member A; epididymis secretory protein Li 42; ras homolog gene family, member Q; ras-like protein TC10; ras-like protein family member 7A; ras homolog family member Q |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcacgggcccggcgcgctgatgctcaagtgcgtggtggtcggcgacggggcggtgggcaagacgtgcctactcatgagctatgccaacgacgccttcccggaggagtacgtgcccaccgtcttcgaccactacgcagtcagcgtcaccgtggggggcaagcagtacctcctaggactctatgacacggccggacaggaagactatgaccgtctgaggcctttatcttacccaatgaccgatgtcttccttatatgcttctcggtggtaaatccagcctcatttcaaaatgtgaaagaggagtgggtaccggaacttaaggaatacgcaccaaatgtaccctttttattaataggaactcagattgatctccgagatgaccccaaaactttagcaagactgaatgatatgaaagaaaaacctatatgtgtggaacaaggacagaaactagcaaaagagataggagcatgctgctatgtggaatgttcagctttaacccagaagggattgaagactgtttttgatgaggctatcatagccattttaactccaaagaaacacactgtaaaaaaaagaataggatcaagatgtataaactgttgtttaattacgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glucagon-like peptide 1 receptor - activating transcription factor 2 - oviductal glycoprotein 1, 120kDa - ADAM metallopeptidase domain 23 |