Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CD300E-CD300e molecule Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD300E-CD300e molecule Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100890 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD300E |
| Origin species: | Human |
| Product name: | CD300E-CD300e molecule Gene |
| Size: | 2ug |
| Accessions: | BC100890 |
| Gene id: | 342510 |
| Gene description: | CD300e molecule |
| Synonyms: | CD300e molecule; CD300e antigen; CD300LE; CLM-2; CLM2; CMRF35-A5; IREM-2; IREM2; PIgR-2; PIgR2; CMRF35-like molecule 2; CD300 antigen-like family member E; immune receptor expressed on myeloid cells 2; poly-Ig receptor 2; polymeric immunoglobulin receptor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggctgctcccagctctactccttctctgcctctcaggctgtttgtctctgaagggccccggctctgtgactggcactgcgggggactctctgacagtgtggtgtcagtatgagagcatgtacaagggatataacaagtactggtgccgaggacagtacgacacgtcatgtgagagcattgtggagaccaagggagaagagaaggtggagaggaatggccgcgtgtccatcagagaccacccggaggctctcgccttcactgtgaccatgcagaacctcaatgaagatgatgctggatcttactggtgcaaaattcagacagtgtgggtcctggattcatggtcacgcgatccctcggacctggttagggtgtatgtttccccagcaattacaaccccaaggaggaccacacatccagccacacctcccatcttcctggtggtgaaccctgggcgaaacctcagcaccagggaggtgttgacccaaaattcagggttccggctcagcagccctcacttcctgctcgtggtccttctgaagctgcccctgctcctgagcatgctgggtgctgtcttctgggtgaacaggcctcagtgggctcctcctggaagatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lysozyme G-like 2 - TWIST neighbor - sorting nexin 18 - sorting nexin 18 |