Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP1R14D-protein phosphatase 1, regulatory (inhibitor) subunit 14D Gene
PTXBC096716
New product
Data sheet of PPP1R14D-protein phosphatase 1, regulatory (inhibitor) subunit 14D Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP1R14D-protein phosphatase 1, regulatory (inhibitor) subunit 14D Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096716 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP1R14D |
| Origin species: | Human |
| Product name: | PPP1R14D-protein phosphatase 1, regulatory (inhibitor) subunit 14D Gene |
| Size: | 2ug |
| Accessions: | BC096716 |
| Gene id: | 54866 |
| Gene description: | protein phosphatase 1, regulatory (inhibitor) subunit 14D |
| Synonyms: | CPI17-like; GBPI-1; GBPI1; protein phosphatase 1 regulatory subunit 14D; PKC-dependent PP1 inhibitory protein; gastrointestinal and brain-specific PP1-inhibitory protein 1; gut and brain phosphatase inhibitor 1; protein phosphatase 1 regulatory inhibitor subunit 14D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgtcttcaagccctgcttcctgcacatctcccagcccagatggggagaacccatgtaagaaggtccactgggcttctgggaggagaaggacatcatccacagactcagagtccaagtcccacccggactcctccaagatacccaggtcccggagacccagccgcctgacagtgaagtatgaccggggccagctccagcgctggctggagatggagcaatgggtggatgctcaagttcaggagctcttccaggatcaagcaaccccttctgagcctgagattgacctggaagctctcatggatctatccacagaggagcagaagactcagctggaggccattcttgggaactgcccccgccccacagaggcttttatctctgagctgctcagtcaactcaagaaactccggagactcagccggcctcagaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Williams Beuren syndrome chromosome region 19 pseudogene - potassium inwardly-rectifying channel, subfamily J, member 4 - protein phosphatase 1, regulatory (inhibitor) subunit 12A - RAS guanyl releasing protein 1 (calcium and DAG-regulated) |