Cart 1 Product Products 121,50 € (empty)
-
1 x QTRT1-queu...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
Data sheet of VHLL-von Hippel-Lindau tumor suppressor-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VHLL-von Hippel-Lindau tumor suppressor-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130596 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VHLL |
| Origin species: | Human |
| Product name: | VHLL-von Hippel-Lindau tumor suppressor-like Gene |
| Size: | 2ug |
| Accessions: | BC130596 |
| Gene id: | 391104 |
| Gene description: | von Hippel-Lindau tumor suppressor-like |
| Synonyms: | VHLP; VLP; von Hippel-Lindau-like protein; VHL pseudogene; VHL-like protein; von Hippel-Lindau tumor suppressor like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccctggagagcggggaacggggtgggtttagaggcccaggcgggcacccaggaggcaggcccagaagagtactgccaggaagagttgggcgccgaggaggagatggcagccagagcagcatggcctgtgctgcgctctgtgaactcacgcgagctctcccggatcatcatctgcaatcacagcccacgaatcgtgctgcctgtgtggctcaactactatggcaagctgctgccctacctgacgctgctgcccggcagggacttccgcatccacaacttccgaagccacccttggctcttcagagatgcaaggacacatgataagcttctggttaaccaaactgaattgtttgtgccatcttccaatgttaatggacagcctgtttttgccaacatcacactgcagtgtataccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 15 open reading frame 32 - interleukin 28B (interferon, lambda 3) - chromosome 17 open reading frame 65 - chromosome 21 open reading frame 67 |