PTXBC132894
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC132894 |
Product type: | DNA & cDNA |
Ncbi symbol: | LOC399900 |
Origin species: | Human |
Product name: | LOC399900-hypothetical gene supported by AK093779 Gene |
Size: | 2ug |
Accessions: | BC132894 |
Gene id: | 399900 |
Gene description: | hypothetical gene supported by AK093779 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgattgggaaggtggaaggtggagacgcggtccttaggtggtcgagcgcattttctcttcctcagagtccaggaaggagcgcgatggagaagtggggcgcacggcgggtttcgggtccgcccctgcccttccgactcctccgaccacgtctgcctttggctgaaagcaaatatggctccgtgtgcggtttctgcaacaaaggctgggcgggccgggtttccctagggatggggaccgcctccccggggagtcgtgggggtgagccaccggggcctccgagagaatcgctggtgtcgcttcgcacccaagggacacatctcgggttagaaaggagaaacgacgtggatctaaaggcgaagcccatgctgaggacttttcaaaatggcctcttatcggccccactcacaggagcttcaggcttcggtggccctgtaggacaaccctggggtgtcattggagagaagctgacggggttaatggcgggtgacaggtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - calcium and integrin binding family member 2 - V-set and transmembrane domain containing 1 - calcium and integrin binding family member 3 - hypothetical gene supported by AK124070 |