PTXBC132894
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC132894 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC399900 |
| Origin species: | Human |
| Product name: | LOC399900-hypothetical gene supported by AK093779 Gene |
| Size: | 2ug |
| Accessions: | BC132894 |
| Gene id: | 399900 |
| Gene description: | hypothetical gene supported by AK093779 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattgggaaggtggaaggtggagacgcggtccttaggtggtcgagcgcattttctcttcctcagagtccaggaaggagcgcgatggagaagtggggcgcacggcgggtttcgggtccgcccctgcccttccgactcctccgaccacgtctgcctttggctgaaagcaaatatggctccgtgtgcggtttctgcaacaaaggctgggcgggccgggtttccctagggatggggaccgcctccccggggagtcgtgggggtgagccaccggggcctccgagagaatcgctggtgtcgcttcgcacccaagggacacatctcgggttagaaaggagaaacgacgtggatctaaaggcgaagcccatgctgaggacttttcaaaatggcctcttatcggccccactcacaggagcttcaggcttcggtggccctgtaggacaaccctggggtgtcattggagagaagctgacggggttaatggcgggtgacaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - calcium and integrin binding family member 2 - V-set and transmembrane domain containing 1 - calcium and integrin binding family member 3 - hypothetical gene supported by AK124070 |