hCG_17241-flamingo-like Gene View larger

hCG_17241-flamingo-like Gene

PTXBC033112

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of hCG_17241-flamingo-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about hCG_17241-flamingo-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033112
Product type: DNA & cDNA
Ncbi symbol: hCG_17241
Origin species: Human
Product name: hCG_17241-flamingo-like Gene
Size: 2ug
Accessions: BC033112
Gene id: 728032
Gene description: flamingo-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgagctctctaggcgagcaaagcctttcagggctgatgtccctcggtcccacgagccaggcctccgcaggctgagcactgagcgctgtctgtctgaccagaacatcatccactcgggcagtgccctcctggccccggccaccagggcagcgtgggagcagatccagcggagcgagggtggcacggcacagctgctccggcgcctcgagggctacttcagcaatgtggcacgcaacgtgcagtggacgtacctgcagccctttgtcatcgtcaccaccaacatgagtaaggcactggctgcgttgggggtggaggcctgcaaccctcaggggtgcgcccaggagctgggtccccatgggtggagcaggtgggctcccggcccccacttggccatgctcttagaaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transglutaminase 5
- glutamine-rich 1
- aldehyde oxidase 1
- WD repeat domain 6

Reviews

Buy hCG_17241-flamingo-like Gene now

Add to cart