Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MAGEA5-melanoma antigen family A, 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAGEA5-melanoma antigen family A, 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109187 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAGEA5 |
| Origin species: | Human |
| Product name: | MAGEA5-melanoma antigen family A, 5 Gene |
| Size: | 2ug |
| Accessions: | BC109187 |
| Gene id: | 4104 |
| Gene description: | melanoma antigen family A, 5 |
| Synonyms: | CT1.5; MAGE5; MAGEA4; melanoma-associated antigen 5; MAGE-5 antigen; MAGE-5a antigen; MAGE-5b antigen; cancer/testis antigen 1.5; cancer/testis antigen family 1, member 5; melanoma antigen family A, 5; melanoma antigen family A5; MAGE family member A5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctcttgagcagaagagtcagcactgcaagcctgaggaaggccttgacacccaagaagaggccctgggcctggtgggtgtgcaggctgccactactgaggagcaggaggctgtgtcctcctcctctcctctggtcccaggcaccctgggggaggtgcctgctgctgggtcaccaggtcctctcaagagtcctcagggagcctccgccatccccactgccatcgatttcactctatggaggcaatccattaagggctccagcaaccaagaagaggaggggccaagcacctcccctgacccagagtctgtgttccgagcagcactcagtaagaaggtggctgacttgattcattttctgctcctcaagtattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical LOC149950 - histone cluster 2, H2aa4 - histone cluster 2, H2aa4 - nanos homolog 2 (Drosophila) |