Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ATOX1-ATX1 antioxidant protein 1 homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATOX1-ATX1 antioxidant protein 1 homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC112248 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATOX1 |
| Origin species: | Human |
| Product name: | ATOX1-ATX1 antioxidant protein 1 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC112248 |
| Gene id: | 475 |
| Gene description: | ATX1 antioxidant protein 1 homolog (yeast) |
| Synonyms: | copper transport protein ATOX1; ATX1; HAH1; ATX1 antioxidant protein 1 homolog; metal transport protein ATX1; antioxidant 1 copper chaperone |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgaagcacgagttctctgtggacatgacctgtggaggctgtgctgaagctgtctctcgggtcctcaataagcttggaggagttaagtatgacattgacctgcccaacaagaaggtctgcattgaatctgagcacagcatggacactctgcttgcaaccctgaagaaaacaggaaagactgtttcctaccttggccttgagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - C-type lectin domain family 12, member A - myosin light chain kinase family, member 4 - zinc finger with KRAB and SCAN domains 1 - CAP-GLY domain containing linker protein 1 |