Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPINK7-serine peptidase inhibitor, Kazal type 7 (putative) Gene
PTXBC109385
New product
Data sheet of SPINK7-serine peptidase inhibitor, Kazal type 7 (putative) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPINK7-serine peptidase inhibitor, Kazal type 7 (putative) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109385 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPINK7 |
| Origin species: | Human |
| Product name: | SPINK7-serine peptidase inhibitor, Kazal type 7 (putative) Gene |
| Size: | 2ug |
| Accessions: | BC109385 |
| Gene id: | 84651 |
| Gene description: | serine peptidase inhibitor, Kazal type 7 (putative) |
| Synonyms: | ECG2; serine protease inhibitor Kazal-type 7; ECRG-2; esophagus cancer-related gene 2 protein; esophagus cancer-related gene-2; serine peptidase inhibitor, Kazal type 7 (putative) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagatcactgggggtctccttctgctctgtacagtggtctatttctgtagcagctcagaagctgctagtctgtctccaaaaaaagtggactgcagcatttacaagaagtatccagtggtggccatcccctgccccatcacatacctaccagtttgtggttctgactacatcacctatgggaatgaatgtcacttgtgtaccgagagcttgaaaagtaatggaagagttcagtttcttcacgatggaagttgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - peptidylprolyl isomerase A (cyclophilin A)-like 4G - ribosomal RNA processing 7 homolog A (S. cerevisiae) - chloride channel, calcium activated, family member 4 - mitogen-activated protein kinase binding protein 1 |