Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DEFB104B-defensin, beta 104B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DEFB104B-defensin, beta 104B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100849 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DEFB104B |
| Origin species: | Human |
| Product name: | DEFB104B-defensin, beta 104B Gene |
| Size: | 2ug |
| Accessions: | BC100849 |
| Gene id: | 503618 |
| Gene description: | defensin, beta 104B |
| Synonyms: | BD-4; DEFB-4; hBD-4; beta-defensin 104; beta-defensin 4; defensin, beta 104; defensin beta 104B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagagacttgtgctgctattagccgtttctcttctactctatcaagatcttccagtgagaagcgaatttgaattggacagaatatgtggttatgggactgcccgttgccggaagaaatgtcgcagccaagaatacagaattggaagatgtcccaacacctatgcatgctgtttgagaaaatgggatgagagcttactgaatcgtacaaaaccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - defensin, beta 106B - transmembrane inner ear - Ras-like without CAAX 1 - UL16 binding protein 3 |