Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GSTM3-glutathione S-transferase mu 3 (brain) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GSTM3-glutathione S-transferase mu 3 (brain) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030253 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GSTM3 |
| Origin species: | Human |
| Product name: | GSTM3-glutathione S-transferase mu 3 (brain) Gene |
| Size: | 2ug |
| Accessions: | BC030253 |
| Gene id: | 2947 |
| Gene description: | glutathione S-transferase mu 3 (brain) |
| Synonyms: | GSTM3-3; GST5; GSTB; GTM3; glutathione S-transferase Mu 3; GST class-mu 3; S-(hydroxyalkyl)glutathione lyase M3; brain GST; brain type mu-glutathione S-transferase; glutathione S-alkyltransferase M3; glutathione S-aralkyltransferase M3; glutathione S-aryltransferase M3; glutathione S-transferase M3 (brain); glutathione S-transferase mu 3 (brain); glutathione S-transferase, Mu-3; hGSTM3-3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcagagggcccaaatggcagggatacccagtgatgtcaggaggaatagtacagacagaaggtgctaagcagacaattcaactgccatgttttgccaccccctgtgagcagggattaggtgttcaggccagtatcttgggcatgggggagcctttggccagaagaggtataaagctcagaagtttttcagtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 16 open reading frame 89 - chromosome 17 open reading frame 54 - chromosome 21 open reading frame 94 - chromosome 21 open reading frame 34 |