Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 067,59 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 067,59 €
Data sheet of SELS-selenoprotein S Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SELS-selenoprotein S Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005840 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SELS |
| Origin species: | Human |
| Product name: | SELS-selenoprotein S Gene |
| Size: | 2ug |
| Accessions: | BC005840 |
| Gene id: | 55829 |
| Gene description: | selenoprotein S |
| Synonyms: | SELS; AD-015; ADO15; SBBI8; SEPS1; VIMP; selenoprotein S; VCP interacting membrane selenoprotein; VCP-interacting membrane protein; valosin-containing protein-interacting membrane protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacgccaagaggagtctctgtccgcgcggccggccctggagaccgaggggctgcgcttcctgcacaccacggtgggctccctgctggccacctatggctggtacatcgtcttcagctgcatccttctctacgtggtctttcagaagctttccgcccggctaagagccttgaggcagaggcagctggaccgagctgcggctgctgtggaacctgatgttgttgttaaacgacaagaagctttagcagctgctcgactgaaaatgcaagaagaactaaatgcgcaagttgaaaagcataaggaaaaactgaaacaacttgaagaagaaaaaaggagacagaagattgaaatgtgggacagcatgcaagaaggaaaaagttacaaaggaaatgcaaagaagccccaggaggaagacagtcctgggccttccacttcatctgtcctgaaacggaaatcggacagaaagcctttgcggggaggaggttataacccgttgtctggtgaaggaggcggagcttgctcctggagacctggacgcagaggcccgtcatctggcggatgaggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CD320 molecule - PLAC8-like 1 - cardiotrophin 1 - neurogenin 3 |