NDN-necdin homolog (mouse) Gene View larger

NDN-necdin homolog (mouse) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDN-necdin homolog (mouse) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NDN-necdin homolog (mouse) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008750
Product type: DNA & cDNA
Ncbi symbol: NDN
Origin species: Human
Product name: NDN-necdin homolog (mouse) Gene
Size: 2ug
Accessions: BC008750
Gene id: 4692
Gene description: necdin homolog (mouse)
Synonyms: HsT16328; PWCR; Prader-Willi syndrome chromosome region; necdin homolog; necdin, melanoma antigen (MAGE) family member; necdin-like protein; necdin, MAGE family member
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagaacaaagtaaggatctgagcgaccctaactttgcagccgaggcccccaactccgaggtgcacagcagccctggggtttcggagggggttcctccgtccgcgaccctggcagagccgcagagccctcctctaggcccgacggccgctccgcaggccgcgccgcctccccaggccccgaacgacgagggcgacccgaaggccctgcagcaggctgcggaggagggccgcgcccaccaggccccgagcgcggcccagccgggcccggcaccgccagccccggcgcagctggtgcagaaggcgcacgagctcatgtggtacgtgctggtcaaggaccagaagaagatgatcatctggtttccagacatggtgaaagatgtcatcggcagctacaagaagtggtgcaggagcatcctccggcgcaccagcctcatcctcgcccgggtgttcgggctgcacctgaggctaaccagcctgcacaccatggagtttgcgctggtcaaagcgctggagcccgaggagctggacagggtggcgctgagcaaccgcatgcccatgacaggcctcctgctcatgatcctgagcctcatctacgtgaagggccgcggcgccagagagagcgccgtctggaacgtgctgcgcatcctggggctgcggccctggaagaagcactccaccttcggggacgtgcggaagctcatcactgaggagttcgtccaaatgaattacctgaagtaccagcgcgtcccatacgtggagccgcccgaatacgagttcttttggggctcccgggccagccgcgaaatcaccaagatgcaaatcatggagttcctggccagggtctttaagaaagacccccaggcctggccctcccgatacagagaagctctggaggaggccagagctctgcgggaggctaatcccactgcccactaccctcgcagcagtgtctctgaggactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - centromere protein M
- defensin, beta 134
- defensin, beta 121
- synaptophysin-like 2

Buy NDN-necdin homolog (mouse) Gene now

Add to cart