Login to display prices
Login to display prices
RPL13-ribosomal protein L13 Gene View larger

RPL13-ribosomal protein L13 Gene

PTXBC007805

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL13-ribosomal protein L13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL13-ribosomal protein L13 Gene

Proteogenix catalog: PTXBC007805
Ncbi symbol: RPL13
Product name: RPL13-ribosomal protein L13 Gene
Size: 2ug
Accessions: BC007805
Gene id: 6137
Gene description: ribosomal protein L13
Synonyms: BBC1; D16S444E; D16S44E; L13; 60S ribosomal protein L13; OK/SW-cl.46; breast basic conserved protein 1; ribosomal protein L13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcccagccggaatggcatggtcttgaagccccacttccacaaggactggcagcggcgcgtggccacgtggttcaaccagccggcccggaagatccgcagacgtaaggcccggcaagccaaggcgcgccgcatcgctccgcgccccgcgtcgggtcccatccggcccatcgtgcgctgccccacggttcggtaccacacgaaggtgcgcgccggccgcggcttcagcctggaggagctcagggtggccggcattcacaagaaggtggcccggaccatcggcatttctgtggatccgaggaggcggaacaagtccacggagtccctgcaggccaacgtgcagcggctgaaggagtaccgctccaaactcatcctcttccccaggaagccctcggcccccaagaagggagacagttctgctgaagaactgaaactggccacccagctgaccggaccggtcatgcccgtccggaacgtctataagaaggagaaagctcgagtcatcactgaggaagagaagaatttcaaagccttcgctagtctccgtatggcccgtgccaacgcccggctcttcggcatacgggcaaaaagagccaaggaagccgcagaacaggatgttgaaaagaaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: