RPL13-ribosomal protein L13 Gene View larger

RPL13-ribosomal protein L13 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL13-ribosomal protein L13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPL13-ribosomal protein L13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007805
Product type: DNA & cDNA
Ncbi symbol: RPL13
Origin species: Human
Product name: RPL13-ribosomal protein L13 Gene
Size: 2ug
Accessions: BC007805
Gene id: 6137
Gene description: ribosomal protein L13
Synonyms: BBC1; D16S444E; D16S44E; L13; 60S ribosomal protein L13; OK/SW-cl.46; breast basic conserved protein 1; ribosomal protein L13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcccagccggaatggcatggtcttgaagccccacttccacaaggactggcagcggcgcgtggccacgtggttcaaccagccggcccggaagatccgcagacgtaaggcccggcaagccaaggcgcgccgcatcgctccgcgccccgcgtcgggtcccatccggcccatcgtgcgctgccccacggttcggtaccacacgaaggtgcgcgccggccgcggcttcagcctggaggagctcagggtggccggcattcacaagaaggtggcccggaccatcggcatttctgtggatccgaggaggcggaacaagtccacggagtccctgcaggccaacgtgcagcggctgaaggagtaccgctccaaactcatcctcttccccaggaagccctcggcccccaagaagggagacagttctgctgaagaactgaaactggccacccagctgaccggaccggtcatgcccgtccggaacgtctataagaaggagaaagctcgagtcatcactgaggaagagaagaatttcaaagccttcgctagtctccgtatggcccgtgccaacgcccggctcttcggcatacgggcaaaaagagccaaggaagccgcagaacaggatgttgaaaagaaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cofilin 1 (non-muscle)
- ribosomal protein S20
- ribosomal protein L24
- PDZ and LIM domain 4

Buy RPL13-ribosomal protein L13 Gene now

Add to cart