KIAA1984-KIAA1984 Gene View larger

KIAA1984-KIAA1984 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIAA1984-KIAA1984 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KIAA1984-KIAA1984 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007542
Product type: DNA & cDNA
Ncbi symbol: KIAA1984
Origin species: Human
Product name: KIAA1984-KIAA1984 Gene
Size: 2ug
Accessions: BC007542
Gene id: 84960
Gene description: KIAA1984
Synonyms: KIAA1984; PARF; bA216L13.7; coiled-coil domain-containing protein 183; coiled-coil domain containing 183
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtccaggaccgaggagggcgacacaaaggtgagggacaccctggagtcctcgactctgatggagaagtacaacaccaggatcagctttgagaaccgggaggaggatatgatcggactgctgcggacgctggggcgaccggggtctcggagaggagcacgggacacgcaggatcgggggaggttctgcgtaaggaggcagcccgggcccggaactgcgcgccagaaccgcgtgcgcatgcgccgaccgcgcgcgccgcgcccccgcggccctcgcggcgccccgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KU-MEL-3
- KIAA1602
- complexin 4
- KIAA0040

Buy KIAA1984-KIAA1984 Gene now

Add to cart