Login to display prices
Login to display prices
KCNIP2-Kv channel interacting protein 2 Gene View larger

KCNIP2-Kv channel interacting protein 2 Gene

PTXBC034685

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNIP2-Kv channel interacting protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCNIP2-Kv channel interacting protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034685
Product type: DNA & cDNA
Ncbi symbol: KCNIP2
Origin species: Human
Product name: KCNIP2-Kv channel interacting protein 2 Gene
Size: 2ug
Accessions: BC034685
Gene id: 30819
Gene description: Kv channel interacting protein 2
Synonyms: KCHIP2; Kv channel-interacting protein 2; A-type potassium channel modulatory protein 2; Kv channel interacting protein 2; cardiac voltage-gated potassium channel modulatory subunit; potassium channel-interacting protein 2; potassium voltage-gated channel interacting protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggggccagggccgcaaggagagtttgtccgattcccgagacctggacggctcctacgaccagctcacgggccaccctccagggcccactaaaaaagcgctgaagcagcgattcctcaagctgctgccgtgctgcgggccccaagccctgccctcagtcagtgaaaacagcgtggacgatgaatttgaattgtccaccgtgtgtcaccggcctgagggtctggagcagctgcaggagcaaaccaaattcacgcgcaaggagttgcaggtcctgtaccggggcttcaagaacgaatgtcccagcggaattgtcaatgaggagaacttcaagcagatttactcccagttctttcctcaaggagactccagcacctatgccacttttctcttcaatgcctttgacaccaaccatgatggctcggtcagttttgaggactttgtggctggtttgtccgtgattcttcggggaactgtagatgacaggcttaattgggccttcaacctgtatgaccttaacaaggacggctgcatcaccaaggaggaaatgcttgacatcatgaagtccatctatgacatgatgggcaagtacacgtaccctgcactccgggaggaggccccaagggaacacgtggagagcttcttccagaagatggacagaaacaaggatggtgtggtgaccattgaggaattcattgagtcttgtcaaaaggatgagaacatcatgaggtccatgcagctctttgacaatgtcatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB31, member RAS oncogene family
- aldolase A, fructose-bisphosphate
- glutathione S-transferase theta 2
- keratin associated protein 4-1