ERGIC3-ERGIC and golgi 3 Gene View larger

ERGIC3-ERGIC and golgi 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ERGIC3-ERGIC and golgi 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ERGIC3-ERGIC and golgi 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009765
Product type: DNA & cDNA
Ncbi symbol: ERGIC3
Origin species: Human
Product name: ERGIC3-ERGIC and golgi 3 Gene
Size: 2ug
Accessions: BC009765
Gene id: 51614
Gene description: ERGIC and golgi 3
Synonyms: C20orf47; CGI-54; Erv46; NY-BR-84; PRO0989; SDBCAG84; dJ477O4.2; endoplasmic reticulum-Golgi intermediate compartment protein 3; endoplasmic reticulum-localized protein ERp43; serologically defined breast cancer antigen 84; serologically defined breast cancer antigen NY-BR-84; ERGIC and golgi 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcgctggggaagctgaagcagttcgatgcctaccccaagactttggaggacttccgggtcaagacctgcgggggcgccaccgtgaccattgtcagtggccttctcatgctgctactgttcctgtccgagctgcagtattacctcaccacggaggtgcatcctgagctctacgtggacaagtcgcggggagataaactgaagatcaacatcgatgtactttttccgcacatgccttgtgcctatctgagtattgatgccatggatgtggccggagaacagcagctggatgtggaacacaacctgttcaagcaacgactagataaagatggcatccccgtgagctcagaggctgagcggcatgagcttgggaaagtcgaggtgacggtgtttgaccctgactccctggaccctgatcgctgtgagagctgctatggtgctgaggcagaagatatcaagtgctgtaacacctgtgaagatgtgcgggaggcatatcgccgtagaggctgggccttcaagaacccagatactattgagcagtgccggcgagagggcttcagccagaagatgcaggagcagaagaatgaaggctgccaggtgtatggcttcttggaagtcaataaggtggccggaaacttccactttgcccctgggaagagcttccagcagtcccatgtgcacgtccatgacttgcagagctttggccttgacaacatcaacatgacccactacatccagcacctgtcatttggggaggactatccaggcattgtgaaccccctggaccacaccaatgtcactgcgccccaagcctccatgatgttccagtactttgtgaaggtggtgcccactgtgtacatgaaggtggacggagaggtgctgaggacaaatcagttctctgtgaccagacatgagaaggttgccaatgggctgttgggcgaccaaggccttcccggagtcttcgtcctctatgagctctcgcccatgatggtgaagctgacggagaagcacaggtccttcacccacttcctgacaggtgtgtgcgccatcattgggggcatgttcacagtggctggactcatcgattcgctcatctaccactcagcacgagccatccagaagaaaattgatctagggaagacaacgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase type 13A2
- arginine vasopressin
- chloride channel 5
- Fc receptor-like 5

Buy ERGIC3-ERGIC and golgi 3 Gene now

Add to cart