Login to display prices
Login to display prices
AURKB-aurora kinase B Gene View larger

AURKB-aurora kinase B Gene

PTXBC009751

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AURKB-aurora kinase B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AURKB-aurora kinase B Gene

Proteogenix catalog: PTXBC009751
Ncbi symbol: AURKB
Product name: AURKB-aurora kinase B Gene
Size: 2ug
Accessions: BC009751
Gene id: 9212
Gene description: aurora kinase B
Synonyms: aurkb-sv2; aurkb-sv1; AIK2; AIM1; ARK2; AurB; IPL1; PPP1R48; STK12; STK5; aurora kinase B; ARK-2; STK-1; aurora kinase B-Sv1; aurora kinase B-Sv2; aurora- and Ipl1-like midbody-associated protein 1; aurora-1; aurora-B; aurora-related kinase 2; aurora/IPL1-related kinase 2; protein phosphatase 1, regulatory subunit 48; serine/threonine kinase 12; serine/threonine-protein kinase 12; serine/threonine-protein kinase 5; serine/threonine-protein kinase aurora-B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccagaaggagaactcctacccctggccctacggccgacagacggctccatctggcctgagcaccctgccccagcgagtcctccggaaagagcctgtcaccccatctgcacttgtcctcatgagccgctccaatgtccagcccacagctgcccctggccagaaggtgatggagaatagcagtgggacacccgacatcttaacgcggcacttcacaattgatgactttgagattgggcgtcctctgggcaaaggcaagtttggaaacgtgtacttggctcgggagaagaaaagccatttcatcgtggcgctcaaggtcctcttcaagtcccagatagagaaggagggcgtggagcatcagctgcgcagagagatcgaaatccaggcccacctgcaccatcccaacatcctgcgtctctacaactatttttatgaccggaggaggatctacttgattctagagtatgccccccgcggggagctctacaaggagctgcagaagagctgcacatttgacgagcagcgaacagccacgatcatggaggagttggcagatgctctaatgtactgccatgggaagaaggtgattcacagagacataaagccagaaaatctgctcttagggctcaagggagagctgaagattgctgacttcggctggtctgtgcatgcgccctccctgaggaggaagacaatgtgtggcaccctggactacctgcccccagagatgattgaggggcgcatgcacaatgagaaggtggatctgtggtgcattggagtgctttgctatgagctgctggtggggaacccaccctttgagagtgcatcacacaacgagacctatcgccgcatcgtcaaggtggacctaaagttccccgcttccgtgcccatgggagcccaggacctcatctccaaactgctcaggcataacccctcggaacggctgcccctggcccaggtctcagcccacccttgggtccgggccaactctcggagggtgctgcctccctctgcccttcaatctgtcgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: