SPN-sialophorin Gene View larger

SPN-sialophorin Gene

PTXBC012350

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPN-sialophorin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPN-sialophorin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012350
Product type: DNA & cDNA
Ncbi symbol: SPN
Origin species: Human
Product name: SPN-sialophorin Gene
Size: 2ug
Accessions: BC012350
Gene id: 6693
Gene description: sialophorin
Synonyms: GALGP; GPL115; LSN; leukosialin; galactoglycoprotein; leukocyte sialoglycoprotein; sialophorin (gpL115, leukosialin, CD43); sialophorin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccacgcttctccttctccttggggtgctggtggtaagcccagacgctctggggagcacaacagcagtgcagacacccacctccggagagcctttggtctctactagcgagcccctgagctcaaagatgtacaccacttcaataacaagtgaccctaaggccgacagcactggggaccagacctcagccctacctccctcaacttccatcaatgagggatcccctctttggacttccattggtgccagcactggttcccctttacctgagccaacaacctaccaggaagtttccatcaagatgtcatcagtgccccaggaaacccctcatgcaaccagtcatcctgctgttcccataacagcaaactctctaggatcccacaccgtgacaggtggaaccataacaacgaactctccagaaacctccagtaggaccagtggagcccctgttaccacggcagctagctctctggagacctccagaggcacctctggaccccctcttaccatggcaactgtctctctggagacttccaaaggcacctctggaccccctgttaccatggcaactgactctctggagacctccactgggaccactggaccccctgttaccatgacaactggctctctggagccctccagcggggccagtggaccccaggtctctagcgtaaaactatctacaatgatgtctccaacgacctccaccaacgcaagcactgtgcccttccggaacccagatgagaactcacgaggcatgctgccagtggctgtgcttgtggccctgctggcggtcatagtcctcgtggctctgctcctgctgtggcgccggcggcagaagcggcggactggggccctcgtgctgagcagaggcggcaagcgtaacggggtggtggacgcctgggctgggccagcccaggtccctgaggagggggccgtgacagtgaccgtgggagggtccgggggcgacaagggctctgggttccccgatggggaggggtctagccgtcggcccacgctcaccactttctttggcagacggaagtctcgccagggctccctggcgatggaggagctgaagtctgggtcaggccccagcctcaaaggggaggaggagccactggtggccagtgaggatggggctgtggacgccccagctcctgatgagcccgaagggggagacggggctgccccttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribokinase
- hephaestin
- cyclin D1
- oculomedin

Buy SPN-sialophorin Gene now

Add to cart