Login to display prices
Login to display prices
GPR173-G protein-coupled receptor 173 Gene View larger

GPR173-G protein-coupled receptor 173 Gene

PTXBC009861

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR173-G protein-coupled receptor 173 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPR173-G protein-coupled receptor 173 Gene

Proteogenix catalog: PTXBC009861
Ncbi symbol: GPR173
Product name: GPR173-G protein-coupled receptor 173 Gene
Size: 2ug
Accessions: BC009861
Gene id: 54328
Gene description: G protein-coupled receptor 173
Synonyms: SREB3; super conserved receptor expressed in brain 3; G protein-coupled receptor 173
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaacactaccggagagcctgaggaggtgagcggcgctctgtccccaccgtccgcatcagcttatgtgaagctggtactgctaggactgattatgtgcgtgagcctggcgggtaacgccatcttgtccctgctggtgctcaaggagcgtgccctgcacaaggctccttactacttcctgctggacctgtgcctggccgatggcatacgctctgccgtctgcttcccctttgtgctggcttctgtgcgccacggctcttcatggaccttcagtgcactcagctgcaagattgtggcctttatggccgtgctcttttgcttccatgcggccttcatgctgttctgcatcagcgtcacccgctacatggccatcgcccaccaccgcttctacgccaagcgcatgacactctggacatgcgcggctgtcatctgcatggcctggaccctgtctgtggccatggccttcccacctgtctttgacgtgggcacctacaagtttattcgggaggaggaccagtgcatctttgagcatcgctacttcaaggccaatgacacgctgggcttcatgcttatgttggctgtgctcatggcagctacccatgctgtctacggcaagctgctcctcttcgagtatcgtcaccgcaagatgaagccagtgcagatggtgccagccatcagccagaactggacattccatggtcccggggccaccggccaggctgctgccaactggatcgccggctttggccgtgggcccatgccaccaaccctgctgggtatccggcagaatgggcatgcagccagccggcggctactgggcatggacgaggtcaagggtgaaaagcagctgggccgcatgttctacgcgatcacactgctctttctgctcctctggtcaccctacatcgtggcctgctactggcgagtgtttgtgaaagcctgtgctgtgccccaccgctacctggccactgctgtttggatgagcttcgcccaggctgccgtcaacccaattgtctgcttcctgctcaacaaggacctcaagaagtgcctgaggactcatgccccctgctggggcacaggaggtgccccggctcccagagaaccctactgtgtcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: