PIM1-pim-1 oncogene Gene View larger

PIM1-pim-1 oncogene Gene

PTXBC020224

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIM1-pim-1 oncogene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PIM1-pim-1 oncogene Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020224
Product type: DNA & cDNA
Ncbi symbol: PIM1
Origin species: Human
Product name: PIM1-pim-1 oncogene Gene
Size: 2ug
Accessions: BC020224
Gene id: 5292
Gene description: pim-1 oncogene
Synonyms: Oncogene PIM1; PIM; serine/threonine-protein kinase pim-1; pim-1 kinase 44 kDa isoform; pim-1 oncogene (proviral integration site 1); proto-oncogene serine/threonine-protein kinase pim-1; Pim-1 proto-oncogene, serine/threonine kinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcttgtccaaaatcaactcgcttgcccacctgcgcgccgcgccctgcaacgacctgcacgccaccaagctggcgcccggcaaggagaaggagcccctggagtcgcagtaccaggtgggcccgctactgggcagcggcggcttcggctcggtctactcaggcatccgcgtctccgacaacttgccggtggccatcaaacacgtggagaaggaccggatttccgactggggagagctgcctaatggcactcgagtgcccatggaagtggtcctgctgaagaaggtgagctcgggtttctccggcgtcattaggctcctggactggttcgagaggcccgacagtttcgtcctgatcctggagaggcccgagccggtgcaagatctcttcgacttcatcacggaaaggggagccctgcaagaggagctggcccgcagcttcttctggcaggtgctggaggccgtgcggcactgccacaactgcggggtgctccaccgcgacatcaaggacgaaaacatccttatcgacctcaatcgcggcgagctcaagctcatcgacttcgggtcgggggcgctgctcaaggacaccgtctacacggacttcgatgggacccgagtgtatagccctccagagtggatccgctaccatcgctaccatggcaggtcggcggcagtctggtccctggggatcctgctgtatgatatggtgtgtggagatattcctttcgagcatgacgaagagatcatcaggggccaggttttcttcaggcagagggtctcttcagaatgtcagcatctcattagatggtgcttggccctgagaccatcagataggccaaccttcgaagaaatccagaaccatccatggatgcaagatgttctcctgccccaggaaactgctgagatccacctccacagcctgtcgccggggcccagcaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CXXC finger 5
- LOC440173
- THO complex 5
- interleukin 10

Buy PIM1-pim-1 oncogene Gene now

Add to cart