ZFYVE19-zinc finger, FYVE domain containing 19 Gene View larger

ZFYVE19-zinc finger, FYVE domain containing 19 Gene

PTXBC015738

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZFYVE19-zinc finger, FYVE domain containing 19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZFYVE19-zinc finger, FYVE domain containing 19 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015738
Product type: DNA & cDNA
Ncbi symbol: ZFYVE19
Origin species: Human
Product name: ZFYVE19-zinc finger, FYVE domain containing 19 Gene
Size: 2ug
Accessions: BC015738
Gene id: 84936
Gene description: zinc finger, FYVE domain containing 19
Synonyms: ANCHR; abscission/NoCut checkpoint regulator; MLL partner containing FYVE domain; zinc finger FYVE domain-containing protein 19; zinc finger, FYVE domain containing 19; zinc finger FYVE-type containing 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagtaggtgctacggctgcgctgtcaagttcaccctcttcaagaaggagtacggctgtaagaattgtggcagggccttctgttcaggctgcctaagcttcagtgcagcagtgcctcggactgggaacacccaacagaaagtctgcaagcaatgccatgaggtcctgaccagagggtcttctgccaatgcctccaagtggtcaccacctcagaactataagaagcgtgtggcagccttggaagccaagcaaaagcccagcacttcccagagccagggactgacacgacaagaccagatgattgctgagcgcctagcacgactccgccaggagaacaagcccaagttagtcccctcacaggcagagatagaggcacggctggctgccctaaaggatgaacgtcagggttccatcccttccacccaggaaatggaggcacgacttgcagcgttgcagggcagagttctaccttctcaaaccccccagccggcacatcacacaccggacaccaggacccaagcccagcagacacaggatctgctaacgcagctggcagctgaggtggctatcgatgaaagctggaaaggaggaggcccagctgcctctctccagaatgatctcaaccagggtggcccagggagcactaattccaagaggcaggccaactggtccttggaggaggagaagagcagactgctggctgaggcagcacttgagttgcgggaggagaacacgaggcaggaacggattctggccctggccaagcgactagccatgctgcggggacaggaccccgagagagtgaccctccaggactatcgcctcccagacagtgatgacgacgaggatgaggagacagccatccaaagagtcctgcagcagctcactgaagaagctgccctggatgaggcaagtggctttaacatccctgcagagcaggcttctcgaccctggacgcaaccccgcggggcagagcctgaggcccaggatgtggaccccaggcctgaggctgaggaagaggagctcccctggtgctgcatctgcaatgaggatgccaccctacgctgcgctggctgcgatggggacctcttctgtgcccgctgcttccgagagggccatgatgcctttgagcttaaagagcaccagacatctgcctactctcctccacgtgcaggccaagagcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - AT hook, DNA binding motif, containing 1
- ATPase family, AAA domain containing 3A
- chromosome 20 open reading frame 191
- chromosome 14 open reading frame 142

Buy ZFYVE19-zinc finger, FYVE domain containing 19 Gene now

Add to cart