Login to display prices
Login to display prices
WDR77-WD repeat domain 77 Gene View larger

WDR77-WD repeat domain 77 Gene

PTXBC009411

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDR77-WD repeat domain 77 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WDR77-WD repeat domain 77 Gene

Proteogenix catalog: PTXBC009411
Ncbi symbol: WDR77
Product name: WDR77-WD repeat domain 77 Gene
Size: 2ug
Accessions: BC009411
Gene id: 79084
Gene description: WD repeat domain 77
Synonyms: HKMT1069; MEP-50; MEP50; Nbla10071; p44; p44/Mep50; methylosome protein 50; WD repeat-containing protein 77; androgen receptor cofactor p44; testis tissue sperm-binding protein Li 44a; WD repeat domain 77
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggaaggaaaccccaccccccctagtgcccccggcggcccgggagtggaatcttcccccaaatgcgcccgcctgcatggaacggcagttggaggctgcgcggtaccggtccgatggggcgcttctcctcggggcctccagcctgagtgggcgctgctgggccggctccctctggctttttaaggacccctgtgccgcccccaacgaaggcttctgctccgccggagtccaaacggaggctggagtggctgacctcacttgggttggggagagaggtattctagtggcctccgattcaggtgctgttgaattgtgggaactagatgagaatgagacacttattgtcagcaagttctgcaagtatgagcatgatgacattgtgtctacagtcagtgtcttgagctctggcacacaagctgtcagtggtagcaaagacatctgcatcaaggtttgggaccttgctcagcaggtggtactgagttcataccgagctcatgctgctcaggtcacttgtgttgctgcctctcctcacaaggactctgtgtttctttcatgcagcgaggacaatagaattttactctgggatacccgctgtcccaagccagcatcacagattggctgcagtgcgcctggctaccttcctacctcgctggcttggcatcctcagcaaagtgaagtctttgtctttggtgatgagaatgggacagtctcccttgtggacaccaagagtacaagctgtgtcctgagctcagctgtacactcccagtgtgtcactgggctggtgttctccccacacagtgttcccttcctggcctctctcagtgaagactgctcacttgctgtgctggactcaagcctttctgagttgtttagaagccaagcccacagagactttgtgagagatgcgacttggtccccgctcaatcactccctggacctgcaagtgttactgagtagattggatttaagacaaaaagcaagtcccccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: